ID: 921079167

View in Genome Browser
Species Human (GRCh38)
Location 1:211725096-211725118
Sequence GTCCAAGTCTCCCACGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921079167_921079170 -9 Left 921079167 1:211725096-211725118 CCAGCACCGTGGGAGACTTGGAC No data
Right 921079170 1:211725110-211725132 GACTTGGACCTAGTGAAGGCCGG No data
921079167_921079174 4 Left 921079167 1:211725096-211725118 CCAGCACCGTGGGAGACTTGGAC No data
Right 921079174 1:211725123-211725145 TGAAGGCCGGTGACCCGGAAGGG No data
921079167_921079178 24 Left 921079167 1:211725096-211725118 CCAGCACCGTGGGAGACTTGGAC No data
Right 921079178 1:211725143-211725165 GGGCCCCTTAAGCTCAGTAATGG No data
921079167_921079173 3 Left 921079167 1:211725096-211725118 CCAGCACCGTGGGAGACTTGGAC No data
Right 921079173 1:211725122-211725144 GTGAAGGCCGGTGACCCGGAAGG No data
921079167_921079172 -1 Left 921079167 1:211725096-211725118 CCAGCACCGTGGGAGACTTGGAC No data
Right 921079172 1:211725118-211725140 CCTAGTGAAGGCCGGTGACCCGG No data
921079167_921079179 25 Left 921079167 1:211725096-211725118 CCAGCACCGTGGGAGACTTGGAC No data
Right 921079179 1:211725144-211725166 GGCCCCTTAAGCTCAGTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921079167 Original CRISPR GTCCAAGTCTCCCACGGTGC TGG (reversed) Intergenic
No off target data available for this crispr