ID: 921079168

View in Genome Browser
Species Human (GRCh38)
Location 1:211725102-211725124
Sequence CACTAGGTCCAAGTCTCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921079168_921079173 -3 Left 921079168 1:211725102-211725124 CCGTGGGAGACTTGGACCTAGTG No data
Right 921079173 1:211725122-211725144 GTGAAGGCCGGTGACCCGGAAGG No data
921079168_921079172 -7 Left 921079168 1:211725102-211725124 CCGTGGGAGACTTGGACCTAGTG No data
Right 921079172 1:211725118-211725140 CCTAGTGAAGGCCGGTGACCCGG No data
921079168_921079174 -2 Left 921079168 1:211725102-211725124 CCGTGGGAGACTTGGACCTAGTG No data
Right 921079174 1:211725123-211725145 TGAAGGCCGGTGACCCGGAAGGG No data
921079168_921079178 18 Left 921079168 1:211725102-211725124 CCGTGGGAGACTTGGACCTAGTG No data
Right 921079178 1:211725143-211725165 GGGCCCCTTAAGCTCAGTAATGG No data
921079168_921079179 19 Left 921079168 1:211725102-211725124 CCGTGGGAGACTTGGACCTAGTG No data
Right 921079179 1:211725144-211725166 GGCCCCTTAAGCTCAGTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921079168 Original CRISPR CACTAGGTCCAAGTCTCCCA CGG (reversed) Intergenic
No off target data available for this crispr