ID: 921079171

View in Genome Browser
Species Human (GRCh38)
Location 1:211725118-211725140
Sequence CCGGGTCACCGGCCTTCACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921079171_921079183 17 Left 921079171 1:211725118-211725140 CCTAGTGAAGGCCGGTGACCCGG No data
Right 921079183 1:211725158-211725180 AGTAATGGGCCTCCACTTGCTGG No data
921079171_921079187 27 Left 921079171 1:211725118-211725140 CCTAGTGAAGGCCGGTGACCCGG No data
Right 921079187 1:211725168-211725190 CTCCACTTGCTGGGAGGTAAAGG No data
921079171_921079188 28 Left 921079171 1:211725118-211725140 CCTAGTGAAGGCCGGTGACCCGG No data
Right 921079188 1:211725169-211725191 TCCACTTGCTGGGAGGTAAAGGG No data
921079171_921079185 21 Left 921079171 1:211725118-211725140 CCTAGTGAAGGCCGGTGACCCGG No data
Right 921079185 1:211725162-211725184 ATGGGCCTCCACTTGCTGGGAGG No data
921079171_921079178 2 Left 921079171 1:211725118-211725140 CCTAGTGAAGGCCGGTGACCCGG No data
Right 921079178 1:211725143-211725165 GGGCCCCTTAAGCTCAGTAATGG No data
921079171_921079179 3 Left 921079171 1:211725118-211725140 CCTAGTGAAGGCCGGTGACCCGG No data
Right 921079179 1:211725144-211725166 GGCCCCTTAAGCTCAGTAATGGG No data
921079171_921079184 18 Left 921079171 1:211725118-211725140 CCTAGTGAAGGCCGGTGACCCGG No data
Right 921079184 1:211725159-211725181 GTAATGGGCCTCCACTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921079171 Original CRISPR CCGGGTCACCGGCCTTCACT AGG (reversed) Intergenic
No off target data available for this crispr