ID: 921079174

View in Genome Browser
Species Human (GRCh38)
Location 1:211725123-211725145
Sequence TGAAGGCCGGTGACCCGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921079158_921079174 28 Left 921079158 1:211725072-211725094 CCCGGAAGGGCCCCTTAACTCTG No data
Right 921079174 1:211725123-211725145 TGAAGGCCGGTGACCCGGAAGGG No data
921079162_921079174 17 Left 921079162 1:211725083-211725105 CCCTTAACTCTGGCCAGCACCGT No data
Right 921079174 1:211725123-211725145 TGAAGGCCGGTGACCCGGAAGGG No data
921079161_921079174 18 Left 921079161 1:211725082-211725104 CCCCTTAACTCTGGCCAGCACCG No data
Right 921079174 1:211725123-211725145 TGAAGGCCGGTGACCCGGAAGGG No data
921079159_921079174 27 Left 921079159 1:211725073-211725095 CCGGAAGGGCCCCTTAACTCTGG No data
Right 921079174 1:211725123-211725145 TGAAGGCCGGTGACCCGGAAGGG No data
921079163_921079174 16 Left 921079163 1:211725084-211725106 CCTTAACTCTGGCCAGCACCGTG No data
Right 921079174 1:211725123-211725145 TGAAGGCCGGTGACCCGGAAGGG No data
921079168_921079174 -2 Left 921079168 1:211725102-211725124 CCGTGGGAGACTTGGACCTAGTG No data
Right 921079174 1:211725123-211725145 TGAAGGCCGGTGACCCGGAAGGG No data
921079167_921079174 4 Left 921079167 1:211725096-211725118 CCAGCACCGTGGGAGACTTGGAC No data
Right 921079174 1:211725123-211725145 TGAAGGCCGGTGACCCGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921079174 Original CRISPR TGAAGGCCGGTGACCCGGAA GGG Intergenic
No off target data available for this crispr