ID: 921079175

View in Genome Browser
Species Human (GRCh38)
Location 1:211725129-211725151
Sequence AAGGGGCCCTTCCGGGTCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921079175_921079187 16 Left 921079175 1:211725129-211725151 CCGGTGACCCGGAAGGGCCCCTT No data
Right 921079187 1:211725168-211725190 CTCCACTTGCTGGGAGGTAAAGG No data
921079175_921079184 7 Left 921079175 1:211725129-211725151 CCGGTGACCCGGAAGGGCCCCTT No data
Right 921079184 1:211725159-211725181 GTAATGGGCCTCCACTTGCTGGG No data
921079175_921079188 17 Left 921079175 1:211725129-211725151 CCGGTGACCCGGAAGGGCCCCTT No data
Right 921079188 1:211725169-211725191 TCCACTTGCTGGGAGGTAAAGGG No data
921079175_921079185 10 Left 921079175 1:211725129-211725151 CCGGTGACCCGGAAGGGCCCCTT No data
Right 921079185 1:211725162-211725184 ATGGGCCTCCACTTGCTGGGAGG No data
921079175_921079178 -9 Left 921079175 1:211725129-211725151 CCGGTGACCCGGAAGGGCCCCTT No data
Right 921079178 1:211725143-211725165 GGGCCCCTTAAGCTCAGTAATGG No data
921079175_921079179 -8 Left 921079175 1:211725129-211725151 CCGGTGACCCGGAAGGGCCCCTT No data
Right 921079179 1:211725144-211725166 GGCCCCTTAAGCTCAGTAATGGG No data
921079175_921079183 6 Left 921079175 1:211725129-211725151 CCGGTGACCCGGAAGGGCCCCTT No data
Right 921079183 1:211725158-211725180 AGTAATGGGCCTCCACTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921079175 Original CRISPR AAGGGGCCCTTCCGGGTCAC CGG (reversed) Intergenic
No off target data available for this crispr