ID: 921079178

View in Genome Browser
Species Human (GRCh38)
Location 1:211725143-211725165
Sequence GGGCCCCTTAAGCTCAGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921079167_921079178 24 Left 921079167 1:211725096-211725118 CCAGCACCGTGGGAGACTTGGAC No data
Right 921079178 1:211725143-211725165 GGGCCCCTTAAGCTCAGTAATGG No data
921079168_921079178 18 Left 921079168 1:211725102-211725124 CCGTGGGAGACTTGGACCTAGTG No data
Right 921079178 1:211725143-211725165 GGGCCCCTTAAGCTCAGTAATGG No data
921079171_921079178 2 Left 921079171 1:211725118-211725140 CCTAGTGAAGGCCGGTGACCCGG No data
Right 921079178 1:211725143-211725165 GGGCCCCTTAAGCTCAGTAATGG No data
921079175_921079178 -9 Left 921079175 1:211725129-211725151 CCGGTGACCCGGAAGGGCCCCTT No data
Right 921079178 1:211725143-211725165 GGGCCCCTTAAGCTCAGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921079178 Original CRISPR GGGCCCCTTAAGCTCAGTAA TGG Intergenic
No off target data available for this crispr