ID: 921079179

View in Genome Browser
Species Human (GRCh38)
Location 1:211725144-211725166
Sequence GGCCCCTTAAGCTCAGTAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921079167_921079179 25 Left 921079167 1:211725096-211725118 CCAGCACCGTGGGAGACTTGGAC No data
Right 921079179 1:211725144-211725166 GGCCCCTTAAGCTCAGTAATGGG No data
921079171_921079179 3 Left 921079171 1:211725118-211725140 CCTAGTGAAGGCCGGTGACCCGG No data
Right 921079179 1:211725144-211725166 GGCCCCTTAAGCTCAGTAATGGG No data
921079168_921079179 19 Left 921079168 1:211725102-211725124 CCGTGGGAGACTTGGACCTAGTG No data
Right 921079179 1:211725144-211725166 GGCCCCTTAAGCTCAGTAATGGG No data
921079175_921079179 -8 Left 921079175 1:211725129-211725151 CCGGTGACCCGGAAGGGCCCCTT No data
Right 921079179 1:211725144-211725166 GGCCCCTTAAGCTCAGTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921079179 Original CRISPR GGCCCCTTAAGCTCAGTAAT GGG Intergenic
No off target data available for this crispr