ID: 921079724

View in Genome Browser
Species Human (GRCh38)
Location 1:211729391-211729413
Sequence GCTTCTAAGCAGTTGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921079718_921079724 12 Left 921079718 1:211729356-211729378 CCAGCTGCAGTCAAGGTTCAACT No data
Right 921079724 1:211729391-211729413 GCTTCTAAGCAGTTGGTGGCAGG No data
921079717_921079724 13 Left 921079717 1:211729355-211729377 CCCAGCTGCAGTCAAGGTTCAAC No data
Right 921079724 1:211729391-211729413 GCTTCTAAGCAGTTGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921079724 Original CRISPR GCTTCTAAGCAGTTGGTGGC AGG Intergenic
No off target data available for this crispr