ID: 921079724 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:211729391-211729413 |
| Sequence | GCTTCTAAGCAGTTGGTGGC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 921079718_921079724 | 12 | Left | 921079718 | 1:211729356-211729378 | CCAGCTGCAGTCAAGGTTCAACT | No data | ||
| Right | 921079724 | 1:211729391-211729413 | GCTTCTAAGCAGTTGGTGGCAGG | No data | ||||
| 921079717_921079724 | 13 | Left | 921079717 | 1:211729355-211729377 | CCCAGCTGCAGTCAAGGTTCAAC | No data | ||
| Right | 921079724 | 1:211729391-211729413 | GCTTCTAAGCAGTTGGTGGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 921079724 | Original CRISPR | GCTTCTAAGCAGTTGGTGGC AGG | Intergenic | ||
| No off target data available for this crispr | |||||