ID: 921079726

View in Genome Browser
Species Human (GRCh38)
Location 1:211729415-211729437
Sequence TTCAGTTTCTTACAGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921079723_921079726 3 Left 921079723 1:211729389-211729411 CCGCTTCTAAGCAGTTGGTGGCA No data
Right 921079726 1:211729415-211729437 TTCAGTTTCTTACAGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921079726 Original CRISPR TTCAGTTTCTTACAGGCTGC TGG Intergenic
No off target data available for this crispr