ID: 921095675

View in Genome Browser
Species Human (GRCh38)
Location 1:211885355-211885377
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921095675_921095680 -1 Left 921095675 1:211885355-211885377 CCACCTCTGCCCGCTTCCTTCAG No data
Right 921095680 1:211885377-211885399 GTCACACACAGATGTTGTTTTGG No data
921095675_921095681 0 Left 921095675 1:211885355-211885377 CCACCTCTGCCCGCTTCCTTCAG No data
Right 921095681 1:211885378-211885400 TCACACACAGATGTTGTTTTGGG No data
921095675_921095682 1 Left 921095675 1:211885355-211885377 CCACCTCTGCCCGCTTCCTTCAG No data
Right 921095682 1:211885379-211885401 CACACACAGATGTTGTTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921095675 Original CRISPR CTGAAGGAAGCGGGCAGAGG TGG (reversed) Intergenic
No off target data available for this crispr