ID: 921095678

View in Genome Browser
Species Human (GRCh38)
Location 1:211885365-211885387
Sequence CTGTGTGTGACTGAAGGAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921095678_921095682 -9 Left 921095678 1:211885365-211885387 CCGCTTCCTTCAGTCACACACAG No data
Right 921095682 1:211885379-211885401 CACACACAGATGTTGTTTTGGGG No data
921095678_921095681 -10 Left 921095678 1:211885365-211885387 CCGCTTCCTTCAGTCACACACAG No data
Right 921095681 1:211885378-211885400 TCACACACAGATGTTGTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921095678 Original CRISPR CTGTGTGTGACTGAAGGAAG CGG (reversed) Intergenic
No off target data available for this crispr