ID: 921095682

View in Genome Browser
Species Human (GRCh38)
Location 1:211885379-211885401
Sequence CACACACAGATGTTGTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921095678_921095682 -9 Left 921095678 1:211885365-211885387 CCGCTTCCTTCAGTCACACACAG No data
Right 921095682 1:211885379-211885401 CACACACAGATGTTGTTTTGGGG No data
921095677_921095682 -8 Left 921095677 1:211885364-211885386 CCCGCTTCCTTCAGTCACACACA No data
Right 921095682 1:211885379-211885401 CACACACAGATGTTGTTTTGGGG No data
921095675_921095682 1 Left 921095675 1:211885355-211885377 CCACCTCTGCCCGCTTCCTTCAG No data
Right 921095682 1:211885379-211885401 CACACACAGATGTTGTTTTGGGG No data
921095674_921095682 2 Left 921095674 1:211885354-211885376 CCCACCTCTGCCCGCTTCCTTCA No data
Right 921095682 1:211885379-211885401 CACACACAGATGTTGTTTTGGGG No data
921095676_921095682 -2 Left 921095676 1:211885358-211885380 CCTCTGCCCGCTTCCTTCAGTCA No data
Right 921095682 1:211885379-211885401 CACACACAGATGTTGTTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921095682 Original CRISPR CACACACAGATGTTGTTTTG GGG Intergenic
No off target data available for this crispr