ID: 921100877

View in Genome Browser
Species Human (GRCh38)
Location 1:211928592-211928614
Sequence TAGGCTGGGCTCATTACAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921100871_921100877 -6 Left 921100871 1:211928575-211928597 CCCTAGAACCCAGCAGGTAGGCT No data
Right 921100877 1:211928592-211928614 TAGGCTGGGCTCATTACAACAGG No data
921100868_921100877 1 Left 921100868 1:211928568-211928590 CCTTTCTCCCTAGAACCCAGCAG No data
Right 921100877 1:211928592-211928614 TAGGCTGGGCTCATTACAACAGG No data
921100872_921100877 -7 Left 921100872 1:211928576-211928598 CCTAGAACCCAGCAGGTAGGCTG No data
Right 921100877 1:211928592-211928614 TAGGCTGGGCTCATTACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921100877 Original CRISPR TAGGCTGGGCTCATTACAAC AGG Intergenic
No off target data available for this crispr