ID: 921102500

View in Genome Browser
Species Human (GRCh38)
Location 1:211941902-211941924
Sequence CTGGGAATAAGGGTCTTCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921102500 Original CRISPR CTGGGAATAAGGGTCTTCCA GGG Exonic
900102391 1:967394-967416 GTGGGACTAAGGGTCTTCACAGG + Intronic
900690506 1:3977794-3977816 CAGGGCATGAGGGTCTTGCAAGG + Intergenic
901422355 1:9159606-9159628 CTGGGAAGAGGGGTCTCCCTGGG + Intergenic
902041116 1:13493205-13493227 CTGGGAACCTGGGTCTTCCCTGG - Intronic
902513072 1:16976620-16976642 CTGGGAGTGGGGGTCTGCCAGGG - Intronic
904327937 1:29739554-29739576 CTGGGCATTTGGCTCTTCCAGGG + Intergenic
910022063 1:82603429-82603451 GTGGGAATCAGGGTCCTCCAAGG + Intergenic
913051809 1:115123175-115123197 CTGTGAATGAGGCTTTTCCAGGG - Intergenic
915644787 1:157261956-157261978 CTTGGAAGTGGGGTCTTCCAAGG + Intergenic
915725821 1:158016709-158016731 CTGGGATTAAGATTTTTCCATGG + Intronic
918279861 1:182993910-182993932 CTGTGAAGAAGCTTCTTCCAAGG - Intergenic
919727676 1:200894734-200894756 CAGGGAAAAAGGGGCTCCCATGG - Intronic
920972080 1:210751495-210751517 CTGGGACTAAGGGGTTTCCCAGG + Intronic
921102500 1:211941902-211941924 CTGGGAATAAGGGTCTTCCAGGG + Exonic
921845890 1:219881563-219881585 CTCGGAATTAGGGTTTTTCAAGG + Intronic
922930633 1:229386319-229386341 CTGGGAGGAACAGTCTTCCAGGG + Intergenic
923467138 1:234259193-234259215 ATAGGAATAAGAATCTTCCAGGG - Intronic
1063490194 10:6457068-6457090 CTGGGATCAAGGGTCTCCAATGG - Intronic
1063729322 10:8677801-8677823 CTGGAAATAGGGGAATTCCATGG + Intergenic
1071291424 10:84192077-84192099 CTGGGACTGAGGGGTTTCCAGGG - Intergenic
1071738620 10:88331199-88331221 ATGTGAATAAGGGTGTCCCAGGG - Intronic
1071970964 10:90906307-90906329 GTGGGAAGAAGAGTCTTCCAGGG + Intronic
1072006028 10:91248342-91248364 CTGTAAATAAGTGTGTTCCATGG + Intronic
1072553691 10:96498189-96498211 CTGCGACTTAGGGTCTCCCATGG - Intronic
1072606477 10:96987863-96987885 CTGGGAAGAAGGTTTTTGCAAGG - Intergenic
1074382695 10:112993162-112993184 TTGTGAATCAGAGTCTTCCAGGG + Intronic
1076049252 10:127319682-127319704 CTGTGAATATGGGCTTTCCATGG - Intronic
1077124590 11:926618-926640 CTGGAAATCAGTGTCTTCCCAGG + Intronic
1079312741 11:19380835-19380857 CTGGGATTTAGGGTTTTCCTGGG + Intronic
1081437928 11:43048368-43048390 CTGGGACTGAGGGTTTTCCTGGG - Intergenic
1081595631 11:44457381-44457403 CTGGGACTAAGGGGTTTCCTGGG + Intergenic
1083234604 11:61343570-61343592 CTGTGAAGAAGGCTCTTCCTGGG + Intronic
1084734578 11:71096249-71096271 CTGGGACTAAGGGACTTCAGTGG + Intronic
1087710160 11:101539447-101539469 CTTGGAATAAGTGTCTTCAGAGG - Intronic
1089112134 11:116065355-116065377 CTAGGAATAAGTGGCTGCCAGGG - Intergenic
1089792058 11:120952685-120952707 CTGGGAATGAGGGTGTTGCCGGG - Intronic
1092232817 12:6786304-6786326 CAAGCATTAAGGGTCTTCCAGGG + Intergenic
1093959535 12:25257064-25257086 GTGAGGATAAGGGTCTTGCATGG - Intergenic
1095600765 12:44010451-44010473 ATGGGAAAACTGGTCTTCCAGGG - Intronic
1096558110 12:52416335-52416357 CTGGCATTGAGGGTCTTGCACGG + Intergenic
1097323050 12:58246653-58246675 TCGGGAATGAAGGTCTTCCAGGG - Intergenic
1099125180 12:78745832-78745854 CTTGCAACTAGGGTCTTCCAGGG - Intergenic
1099970539 12:89495653-89495675 CATGGAAAAATGGTCTTCCATGG - Intronic
1100265835 12:92975077-92975099 CTTGCAATTGGGGTCTTCCAGGG + Intergenic
1101802377 12:108033612-108033634 CTGGGAATCAGGGACATCCAAGG - Intergenic
1102305879 12:111804134-111804156 CTGGGGATCAGGGCCTGCCAGGG + Intronic
1102998191 12:117365415-117365437 CTGGGAAGAAGGGGGTTCCTGGG + Intronic
1103875197 12:124121713-124121735 CTGGGAAAAGTGGTCTTCCAGGG - Intronic
1103884612 12:124191276-124191298 CTGGGCAGAAGACTCTTCCATGG - Intronic
1106085921 13:26541584-26541606 CTGGGGCTAAGGGTGTTACAGGG - Intergenic
1108975272 13:56434673-56434695 GAGGAAATAAGTGTCTTCCATGG + Intergenic
1109091092 13:58047058-58047080 CAGGGATTAAGTGTGTTCCAGGG - Intergenic
1109509480 13:63351274-63351296 CTTGGAATAAGGTTCTACTATGG + Intergenic
1110225036 13:73110762-73110784 CTGGAAGTGAGGGTATTCCAGGG + Intergenic
1121865278 14:97357016-97357038 CAGGCAAGAAGGGCCTTCCAGGG - Intergenic
1122087186 14:99316232-99316254 CTGGGAATCAGAGTCCTCCAGGG - Intergenic
1124209409 15:27750700-27750722 GTGGGAATAATGGGATTCCAAGG + Intergenic
1124362627 15:29049235-29049257 CTGGGCATCAGGGTTTTCAATGG + Intronic
1126463451 15:48938390-48938412 AGAGGAATAAGGGCCTTCCAGGG - Intronic
1128150362 15:65359636-65359658 CTTGGAAGAAGGGTGTTTCAGGG + Intronic
1128944979 15:71813835-71813857 CTGGGGCTCAGGGTCTCCCAGGG - Intronic
1129341400 15:74888792-74888814 GTGGGAATGAGGGTATTGCAGGG + Intergenic
1132169249 15:99630862-99630884 CTTGGATTTAGGGTCTGCCAAGG - Intronic
1134019389 16:10910962-10910984 CTGGGACTAAGGGGCTTCTTGGG - Intronic
1137754103 16:50887851-50887873 CTGGGAATAGCGGTCTCTCAGGG + Intergenic
1139161335 16:64514457-64514479 CAGGAAATATGGATCTTCCATGG + Intergenic
1140330900 16:74055854-74055876 TTTGGAAAAAGGGTCTTCCCAGG - Intergenic
1142131677 16:88434132-88434154 CCAGGAGGAAGGGTCTTCCAGGG - Exonic
1143792386 17:9307918-9307940 TTTGGAATGAGGGTCTTCAAGGG - Intronic
1144257753 17:13486378-13486400 CTGGCAATGAGTGCCTTCCAGGG - Intergenic
1145302989 17:21653787-21653809 CTGGGGACAAGGGTCTCCCTGGG - Intergenic
1145347051 17:22048054-22048076 CTGGGGACAAGGGTCTCCCTGGG + Intergenic
1146508070 17:33422589-33422611 CTGGAAATGAGGGTCTTTCCTGG + Intronic
1146557556 17:33839630-33839652 CTGAGAATAAGGGGTTTCCTGGG - Intronic
1147872632 17:43598325-43598347 CTGGGATGAAGGGTATTTCATGG + Intergenic
1149981187 17:61312702-61312724 CTGGCCTTTAGGGTCTTCCAAGG - Intronic
1150263813 17:63818663-63818685 TTGGGATAAAGGGTCTTCTAGGG + Exonic
1152287929 17:79423220-79423242 CTGGAAAGATGGGGCTTCCACGG - Intronic
1152682811 17:81678018-81678040 TCGGGAATGAGGGTCTTCCAGGG - Intergenic
1153756025 18:8284107-8284129 CTGGTAATGTGGGTCCTCCAAGG + Intronic
1154172742 18:12063081-12063103 CTGGGGATCAGGGTCTCCCTGGG + Intergenic
1154998361 18:21662588-21662610 CTGGGCATAAGGATCGTCCATGG + Intronic
1157015204 18:43703897-43703919 TTTGGAATGAGGGTCTTCAAGGG - Intergenic
1158026271 18:52900841-52900863 CTGGGAATCAAGGTTTTCCTAGG + Intronic
1159255779 18:65943504-65943526 CTCAGAATAAAGGTTTTCCAGGG + Intergenic
1163636570 19:18439669-18439691 CCCGGAATGAGGGTCTTCAAGGG - Intergenic
1165121684 19:33563062-33563084 CTGGGAAGAAGGGCCTGCCTTGG + Intergenic
1168138267 19:54366367-54366389 CTGGAAATAAGGATCTTACTTGG + Intronic
1168272404 19:55257576-55257598 GTGGGAAGAAGGGCCTTCCGGGG - Intronic
1168604541 19:57747882-57747904 CTGGGTTTAAGGTTCCTCCAGGG - Intronic
925384105 2:3450018-3450040 CTGGGCATCAGGGCTTTCCAGGG + Intronic
926662391 2:15481919-15481941 TCTGGAATAAGGGTCTTCAAGGG - Intronic
927104818 2:19814585-19814607 CTGGGAATGATGGGATTCCAGGG - Intergenic
929036762 2:37700456-37700478 CTGGCCTTAAGGATCTTCCATGG + Intronic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
930127652 2:47815318-47815340 TCGGGAATGAGGATCTTCCAGGG + Intronic
931690941 2:64834402-64834424 CTGGGACTGAGGGACTTCCTGGG - Intergenic
931712996 2:65005646-65005668 CTTGAAATGATGGTCTTCCAAGG + Intronic
932747311 2:74344653-74344675 CTGGGACTAAGGGGTTTCCTGGG - Intronic
932930064 2:76025056-76025078 CTGGGAATCCAGGTGTTCCAGGG - Intergenic
933076027 2:77927579-77927601 ATGGGAATAGGGCTGTTCCATGG + Intergenic
934750834 2:96793157-96793179 CTGGGCAGAAAGGGCTTCCAGGG + Intronic
935140902 2:100352018-100352040 CTGGGAATAAGGGGAATCCCGGG + Intergenic
937156812 2:119725494-119725516 CTGGGACTAAGGGGTTTCCCGGG + Intergenic
937219807 2:120336217-120336239 CTGGGATGAAGGGTTTTCCTGGG - Intergenic
938083937 2:128385917-128385939 CTTGGACTAAGTGTCTGCCATGG + Intergenic
941293746 2:163709674-163709696 CTGGGAAGAAGGGGCTTCTCGGG - Intronic
943082006 2:183267046-183267068 TCGGGAATGAGGGTCTTCCAGGG + Intergenic
945246247 2:207719860-207719882 CTGGGACTAAGAGTTTTCCAAGG + Intronic
946542356 2:220698694-220698716 CTTGGAATATGAGTCTTGCAGGG - Intergenic
948579259 2:238972962-238972984 CTGGGACTGAGGGGTTTCCAGGG - Intergenic
1168976322 20:1968768-1968790 CTGGGCAGAAGGGTCCTACATGG - Intergenic
1169135435 20:3194425-3194447 CTGGGAACTTGGGTCTTTCAGGG - Intronic
1171520509 20:25771479-25771501 CTGGGGACAAGGGTCTCCCTGGG - Intronic
1171556410 20:26085014-26085036 CTGGGGACAAGGGTCTCCCTGGG + Intergenic
1173497925 20:43532616-43532638 CTGGGAAAGAGGGCCCTCCAGGG - Intronic
1173754990 20:45508184-45508206 ATGGGCACAAGGTTCTTCCATGG - Intergenic
1174450532 20:50617319-50617341 CTGGGAAGAAGGGGCTGCCTTGG + Intronic
1174768126 20:53272912-53272934 CTGAGAATGAGGGGCTACCAAGG + Intronic
1175614189 20:60378852-60378874 CTTGTAAGAAGGGTCTTCCAGGG - Intergenic
1180075209 21:45458516-45458538 CTGGGCATTTGGGTGTTCCAGGG - Intronic
1182353415 22:29711261-29711283 CTGGGAACAGGGGTCTTCTTGGG + Intergenic
1182782449 22:32878896-32878918 GTGGGAATGAGGGTCCTGCATGG + Intronic
1183154772 22:36066474-36066496 CCGGGTGTAAGGGTCTTCCGGGG - Intergenic
1183323179 22:37177436-37177458 CTTGGATTAAGGGTCTACCAGGG - Intergenic
951991951 3:28684836-28684858 CTGGGAACATGTTTCTTCCAGGG - Intergenic
952976982 3:38704920-38704942 CTGGGAAGAAGGGTCTTAGTTGG + Intronic
953581120 3:44157531-44157553 CTGGGAAGAAGGGCCTTCAGTGG + Intergenic
954043889 3:47912277-47912299 CTGTGATCAAGAGTCTTCCATGG + Intronic
954383133 3:50230160-50230182 CTGGGAAGAGGGGTCTGCAAGGG + Intronic
954794856 3:53156393-53156415 CTGGGTGTGAGGGTCGTCCAGGG - Intronic
956202561 3:66721368-66721390 CTGGGGCCCAGGGTCTTCCAAGG + Intergenic
957702685 3:83737797-83737819 TTGAGAACAAGGGTATTCCATGG - Intergenic
959735980 3:109659429-109659451 CTGGGAATTAAGGTCTACCTGGG + Intergenic
962464160 3:135641251-135641273 CTGGGACTAAAGGGCTTCCTGGG + Intergenic
966639640 3:182175511-182175533 CTGGGAAGAAGAGACATCCAGGG - Intergenic
967883025 3:194314966-194314988 CTGGCTGGAAGGGTCTTCCATGG - Intergenic
970110666 4:12634445-12634467 CTGCCAATAAGTGTCTTCTAGGG - Intergenic
971056683 4:22921088-22921110 CTGGAAGGAAGCGTCTTCCAGGG - Intergenic
973904872 4:55518883-55518905 CTGGGATTCAGTGTCATCCAGGG - Intronic
976315616 4:83655792-83655814 CTGGGCATAAGGGACTACCTTGG + Intergenic
977383309 4:96305171-96305193 CTGGAGATAAGGGGCCTCCAGGG + Intergenic
980526123 4:133992897-133992919 CTGGGACTGTGGGTCTTGCAGGG + Intergenic
985126199 4:186697144-186697166 GTGGCATTAAGGGTTTTCCATGG + Intronic
985155523 4:186983529-186983551 CTAGGGAAAAGTGTCTTCCAAGG + Intergenic
989141777 5:38208647-38208669 CTGGGGCTAAGCATCTTCCACGG + Intergenic
991351671 5:65725809-65725831 CTGGTAAAAATGGTGTTCCATGG + Intronic
991640078 5:68743360-68743382 CTGGAACTGAGGGACTTCCAGGG - Intergenic
992066465 5:73114414-73114436 CAGGGAGCAAGGGTCTTCCTGGG - Intergenic
992818281 5:80467055-80467077 CTTGTAAGTAGGGTCTTCCAGGG - Intronic
994243524 5:97451499-97451521 CCTGGAATAAGGGGCTTCCTGGG + Intergenic
999396019 5:151228718-151228740 CTGGAGATATGGGACTTCCAGGG - Intronic
999692335 5:154158948-154158970 CTGGGAATCAGGGTGTTCAGGGG + Intronic
1001043951 5:168356823-168356845 CTGGGAATAAGGGAAGCCCATGG + Intronic
1001125998 5:169019941-169019963 TTGGGAATAAGTGTTTTCCCTGG + Intronic
1002321599 5:178379443-178379465 CTGGGCAGAGGGGTCTTGCAGGG + Intronic
1002900612 6:1406863-1406885 CTGAGAAAAAGAGTCTTGCAAGG - Intergenic
1003406081 6:5828313-5828335 CTTTGAATGCGGGTCTTCCAGGG + Intergenic
1003419967 6:5948463-5948485 TTGGGAAGAAGGGTCTGCCTTGG - Intergenic
1003827974 6:9973746-9973768 CTGGCAATAAACGTCTTCTAAGG + Intronic
1004139817 6:13007500-13007522 CTTAGAATAAGAGTCTTCCTTGG + Intronic
1004465774 6:15883408-15883430 CTGGGAAGAGGGCTCTTCCAGGG - Intergenic
1004645564 6:17557021-17557043 CAGAGAATATAGGTCTTCCAAGG - Exonic
1007107432 6:39293505-39293527 CTGGAAATAAGGGGGTTCCTTGG + Intergenic
1007781753 6:44258366-44258388 CTGGGGATAAGGGTAACCCAGGG - Exonic
1011395830 6:86906169-86906191 CTAGGAGTAAGGGTTTTCCTGGG - Intergenic
1012594673 6:101025244-101025266 CAGGTAATAAGGGATTTCCAAGG + Intergenic
1014164569 6:118209016-118209038 CTTGGAATGAGGGTCTTCAAGGG - Intronic
1014698606 6:124655557-124655579 TTGGGACTAAGGGGCTTCCAAGG + Intronic
1018695917 6:166391285-166391307 TCTGGAATAAGGGTCTTCAACGG + Intergenic
1019041238 6:169107967-169107989 CTGGGAATTAGGCTACTCCATGG + Intergenic
1019323665 7:426798-426820 CTGCGAGTCAGGGTCTTCCTGGG - Intergenic
1020692333 7:11371339-11371361 CTGGGAATAAGGGTCTCCCCAGG - Exonic
1021107085 7:16649532-16649554 CTGGAAATCAGGGTCTTTAATGG - Intronic
1022148426 7:27571992-27572014 CTGGGAGAAAGGGTGTTCTATGG - Intronic
1024030635 7:45456857-45456879 CTGGGAATGAGAGGCTTCCTGGG - Intergenic
1024030639 7:45456875-45456897 CTGGGAATGAGAGGCTTCCTGGG - Intergenic
1025280999 7:57626443-57626465 CTGGGGACAAGGGTCTCCCTGGG - Intergenic
1025303730 7:57839064-57839086 CTGGGGACAAGGGTCTCCCTGGG + Intergenic
1028461716 7:91101427-91101449 ATGGGAATGAGTGTCTGCCAGGG + Intronic
1030738226 7:113076465-113076487 CTGGGAATAATGGTCCTGGAAGG + Intergenic
1031713554 7:125078833-125078855 CTGGAAATAAACGTCTTTCAAGG + Intergenic
1033452934 7:141477671-141477693 ATGGGGATCAGGGGCTTCCAGGG + Exonic
1034196052 7:149248340-149248362 TTGGAAATAAGGTACTTCCAAGG - Intronic
1034385106 7:150734501-150734523 CTGGGACTAAGGGGTTTCCCAGG + Intronic
1034575756 7:151995537-151995559 CAGGGAAACAGTGTCTTCCAGGG + Intronic
1034641712 7:152609228-152609250 CTTGGAATAATTGTTTTCCAAGG - Intergenic
1036570533 8:9976359-9976381 CTGTAAATAAGGCCCTTCCAGGG + Intergenic
1039912451 8:41835891-41835913 CTGGGCATGAGGGTCCTCCCAGG - Intronic
1040043967 8:42942484-42942506 CTGGGAATCATGGTTTTCCCTGG - Intronic
1043708108 8:83378468-83378490 CTGGGTATGTGGGTGTTCCAGGG - Intergenic
1045288664 8:100813183-100813205 CTTGGAATGAGGGTCTTCAAGGG - Intergenic
1047095722 8:121623380-121623402 TTTGGAATAAGGGTCCTTCATGG - Intronic
1048027254 8:130598001-130598023 CTGGGACTAATTTTCTTCCAGGG + Intergenic
1048906867 8:139096944-139096966 AAGGGAAAAAGGGGCTTCCAAGG - Intergenic
1049258604 8:141626870-141626892 CTGGGATTCAGGGCCTTCCCGGG + Intergenic
1050142620 9:2532371-2532393 CAGGGAAAAAGTCTCTTCCAAGG - Intergenic
1050453017 9:5803974-5803996 CTGGCTATAAGGGACTTCCACGG + Intronic
1055491748 9:76812186-76812208 CTGGGAAGACAGGGCTTCCAAGG + Intronic
1056869099 9:90260137-90260159 CTTTGAATAAGTGTCTTGCATGG - Intergenic
1059547437 9:115192338-115192360 CTGTGATTAAAGGTCTTCAAAGG - Intronic
1062029865 9:134357339-134357361 CTGGGAAAAGGGGACTTTCAGGG + Intronic
1062724025 9:138061121-138061143 CTGGGAATCAGGGGCTTCACTGG - Intronic
1185698943 X:2215854-2215876 TTGGGAATAAGGATCTTTGAAGG + Intergenic
1186331574 X:8540446-8540468 CTGGGAATAAACGTGTTCAAAGG - Intronic
1186400549 X:9254942-9254964 CTGGGAATAAGCAGTTTCCAAGG - Intergenic
1187394360 X:18906877-18906899 CAGAAAATAAGGGTGTTCCATGG - Intronic
1187724367 X:22187230-22187252 CTGGGAATAATCCCCTTCCAAGG + Intronic
1188083368 X:25873451-25873473 CTAGGACTAAGGGTTTTCCCAGG - Intergenic
1189192082 X:39118994-39119016 CTGGGAATTTATGTCTTCCAAGG - Intergenic
1189624544 X:42882307-42882329 ATGGGAATAAGGGAGTCCCAGGG - Intergenic
1195608711 X:106838799-106838821 CTGGGAATAGAGATTTTCCAGGG + Intronic
1196166795 X:112544148-112544170 CTGGGAATCAGTGTCAACCATGG + Intergenic
1196610967 X:117714433-117714455 CTGGGGATGGGTGTCTTCCATGG - Intergenic
1196745309 X:119066499-119066521 CTAGGAAAAAGATTCTTCCAGGG - Intergenic
1201431041 Y:13902165-13902187 CTGGGAATAAACGTGTTCAAAGG + Intergenic
1202339179 Y:23842767-23842789 GTGGGAGTAAGTGCCTTCCAGGG + Intergenic
1202531587 Y:25827305-25827327 GTGGGAGTAAGTGCCTTCCAGGG - Intergenic