ID: 921106173

View in Genome Browser
Species Human (GRCh38)
Location 1:211981157-211981179
Sequence CTGGAACAAGATGCTGTCTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921106173_921106176 18 Left 921106173 1:211981157-211981179 CCAAAGACAGCATCTTGTTCCAG 0: 1
1: 0
2: 3
3: 14
4: 184
Right 921106176 1:211981198-211981220 AAAAACAGTAAACTTTATGATGG 0: 1
1: 0
2: 2
3: 55
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921106173 Original CRISPR CTGGAACAAGATGCTGTCTT TGG (reversed) Exonic
901280386 1:8029226-8029248 GTGTAAGAAGAAGCTGTCTTTGG + Intergenic
901319192 1:8329496-8329518 CTGGAAGAAGCTGCAGTGTTTGG + Intronic
901470166 1:9450524-9450546 CTGGAAGGAGATGATGTCTACGG - Intergenic
902720945 1:18303502-18303524 CTGGGTGAAGATGCTGTCTCTGG - Intronic
903301716 1:22383840-22383862 CTGGAACAGGACACTGCCTTAGG + Intergenic
906759381 1:48360781-48360803 CTGGAAAAGCATGCTGGCTTGGG + Intronic
910489298 1:87751039-87751061 AGGGAAGAAGAGGCTGTCTTGGG - Intergenic
912939224 1:114030376-114030398 CTGGAAGAAGATAGTTTCTTTGG - Intergenic
913210639 1:116579598-116579620 GTGGGCCCAGATGCTGTCTTTGG - Exonic
914674901 1:149900611-149900633 CTGAAGCAAGTTGCTATCTTCGG - Intronic
916646572 1:166792541-166792563 CTGGACAAAGAGGTTGTCTTTGG + Intergenic
917601219 1:176576117-176576139 CTGGAGCATGAGGCTGTTTTTGG + Intronic
918928984 1:190828309-190828331 ATGGGGTAAGATGCTGTCTTGGG + Intergenic
920613687 1:207468222-207468244 CTTGATCGAGATGCTGACTTAGG - Intronic
921106173 1:211981157-211981179 CTGGAACAAGATGCTGTCTTTGG - Exonic
922471035 1:225877452-225877474 CTGGAGCACGGTGCTGTTTTTGG + Exonic
923717866 1:236441418-236441440 CTGGAAGAAGATGCCATCTAGGG - Intronic
1063342063 10:5275271-5275293 CAGGAAGAAGCTGCTGTCCTGGG - Intergenic
1065895309 10:30158269-30158291 CTAGAACAATATGCTGTCCCAGG - Intergenic
1066036558 10:31493691-31493713 CTGCAAAAAAATGCTGCCTTGGG - Intronic
1066206422 10:33193627-33193649 CTGGTATTAGATGCTGTATTAGG + Intronic
1068912628 10:62395058-62395080 CTGGGGCAAGAAGCTGTCCTCGG + Intronic
1070440318 10:76436567-76436589 CAGTGACAAGATGCTGGCTTTGG + Intronic
1071276455 10:84059901-84059923 CTGCAACAAGATGCAATCCTGGG + Intergenic
1072282567 10:93881048-93881070 CTGGAACCAGATGCCAACTTTGG + Intergenic
1075013003 10:118890977-118890999 CTTGAACAAGAAACTGACTTGGG + Intergenic
1075202951 10:120421510-120421532 CTGGAACACGTTTCTGACTTGGG + Intergenic
1075477938 10:122752776-122752798 TTGGAACAAGAAGTTCTCTTTGG + Intergenic
1076380306 10:130020788-130020810 CAGGAACACGAGGCTGTCATCGG + Intergenic
1076540950 10:131214347-131214369 CTGGAACAAGATCCTGTGGAAGG - Intronic
1079859789 11:25654517-25654539 CTGGAACAAGATGCTGATAGTGG - Intergenic
1080661646 11:34301164-34301186 GTGGACCAAGATGCTGTCAGAGG - Intronic
1083242465 11:61399094-61399116 GTGAGACAAGATGCTGACTTTGG - Intergenic
1083953951 11:65972288-65972310 CTGGGACACGATTCTGTCTCGGG - Intronic
1086740018 11:90355316-90355338 CTGGCACAAGATGCTTCCTGTGG + Intergenic
1087146897 11:94821683-94821705 CTGGACCAAGCTGCTGGCTGGGG - Exonic
1088758980 11:112911609-112911631 CTTAAAAAAGAGGCTGTCTTGGG + Intergenic
1090713295 11:129407694-129407716 CTGGACTAAGATGCAGTTTTTGG + Intronic
1091453662 12:589609-589631 TTGTAACAGGATGATGTCTTAGG - Intronic
1091853618 12:3721208-3721230 CTAGTAAAAGATGCTGTGTTAGG + Intronic
1092167073 12:6348769-6348791 CTTGAAGAAGATGTTGACTTTGG + Exonic
1092969839 12:13682973-13682995 CTCCAGAAAGATGCTGTCTTTGG + Intronic
1094293942 12:28882349-28882371 CTGGAATAAGATTCTGGATTTGG - Intergenic
1097171227 12:57114468-57114490 CTTGATCAAGATGCTGTTATGGG - Intronic
1098885785 12:75959510-75959532 CTGGAAGAAGATGATGGGTTTGG + Intergenic
1098945674 12:76586954-76586976 CTTATACAAGATGCTGTTTTGGG + Intergenic
1101411311 12:104470785-104470807 CTGGAACAGGATCCTGGCTCAGG + Intronic
1101559618 12:105844140-105844162 ATGGAATGAGATGCTGTCATTGG - Intergenic
1102116414 12:110406482-110406504 CTGGAAGAAGATATTTTCTTTGG + Intergenic
1106277659 13:28228521-28228543 CTGAAATAAGATGTTTTCTTAGG + Intronic
1107052364 13:36064992-36065014 CTGTAAAAAAATGCTTTCTTTGG + Intronic
1108511021 13:51156019-51156041 CTGGAACAACATTTTCTCTTAGG + Intergenic
1109618415 13:64868049-64868071 AAAGAACCAGATGCTGTCTTTGG - Intergenic
1110012690 13:70357510-70357532 CTGGAACAAGATTCTGTCTCAGG + Intergenic
1114614125 14:24059395-24059417 CGGGGCCAAGATGCTGTCTAAGG + Exonic
1115403938 14:32994976-32994998 TTGAATCAAGATTCTGTCTTTGG + Intronic
1115647596 14:35380297-35380319 CAAGAACAAGACTCTGTCTTGGG + Intergenic
1115981131 14:39052833-39052855 CTAGGACAAGATGCTGTCTGAGG + Intronic
1120703754 14:87726245-87726267 CTGGAATAAGAACCTGGCTTTGG + Intergenic
1122179170 14:99943276-99943298 TTGGAACAAGTGCCTGTCTTGGG - Intergenic
1202847326 14_GL000009v2_random:191716-191738 CTGTAACAAAGTGCTTTCTTGGG - Intergenic
1124986092 15:34616542-34616564 CTTGAACAAAATGCTGCCATGGG + Intergenic
1125018135 15:34957884-34957906 CTGAAAGAAGTAGCTGTCTTTGG - Intronic
1125205849 15:37152971-37152993 CTGGAAAAAGATGCTGTGTGGGG + Intergenic
1127362297 15:58255067-58255089 CTAGTTCATGATGCTGTCTTAGG + Intronic
1127495578 15:59508572-59508594 CTGGTAGAAGTTGCGGTCTTGGG + Intronic
1127996162 15:64154072-64154094 CAGGAAGGAGATGCTGTCTGAGG - Intronic
1128358697 15:66945663-66945685 CTGGAAGAAGATGGTGGCTCTGG - Intergenic
1130436081 15:83901320-83901342 CTGGAACAATAAGCTTTCCTGGG - Intronic
1131232911 15:90672498-90672520 CTTGAACATGACGCTGTCCTGGG + Intergenic
1133808062 16:9140242-9140264 CTGGAACAAGACGTCGTTTTCGG + Intergenic
1134677721 16:16102343-16102365 CTGGCACAGGATGCTGGCTCAGG + Intronic
1136360233 16:29774705-29774727 GTGGAACAAGAAGCAGTCTTCGG + Intergenic
1139674810 16:68516219-68516241 CTAGAACAAGATCCTATCTCCGG - Intergenic
1139975459 16:70806614-70806636 CTGGAAGAAGATGGCCTCTTGGG - Intergenic
1140816396 16:78625013-78625035 CTGGAACAAGAGCCTGTCTTTGG + Intronic
1141788343 16:86216596-86216618 CTGGAAAAGGATGCTGACCTCGG + Intergenic
1142120635 16:88384905-88384927 CTGGAACAGGCTGCTGTGATGGG - Intergenic
1142944786 17:3415733-3415755 ATTAAACATGATGCTGTCTTTGG + Intergenic
1145329701 17:21861100-21861122 CTGGAACAAAATGCTATCGAAGG + Intergenic
1147851830 17:43449620-43449642 CAGAAGCAGGATGCTGTCTTGGG + Intergenic
1148890767 17:50805723-50805745 CTGGAAAAAGTTGCTGGCTTAGG - Intergenic
1149045972 17:52246052-52246074 CAGAAACATGATGCTGTCATCGG - Intergenic
1149460210 17:56822989-56823011 CAGGAACATGATGCTGACCTTGG - Intronic
1150137083 17:62701980-62702002 GATGACCAAGATGCTGTCTTTGG - Intronic
1150205253 17:63399987-63400009 CTGGAAACAGCTGCTGTCTCTGG + Intronic
1151442793 17:74143981-74144003 CAGCAACAAGGTGCTGTCTGTGG - Intergenic
1151471614 17:74321857-74321879 GTGGAACAGGATGCTGTGATGGG + Intergenic
1157940089 18:51918932-51918954 TTGGAACAAGACCCTGTCTGTGG - Intergenic
1158063721 18:53379443-53379465 CTAGACCAAGATGCTGTACTTGG - Intronic
1164645401 19:29855556-29855578 CTGGAACAACATGATCTCTTGGG - Intergenic
1168222399 19:54970006-54970028 GTGGGACAAGATGGTGTCTTCGG + Exonic
926098461 2:10097916-10097938 ATGGAACGACATGCTGTGTTTGG - Intergenic
927134478 2:20086741-20086763 CTGGAAGGAGATGTTTTCTTTGG - Intergenic
928171387 2:29006768-29006790 GTGGAGCAAGCTGCTGTCTGAGG - Intronic
930548479 2:52800452-52800474 CTGGAACGAGAAGCAGTATTGGG - Intergenic
930884815 2:56313743-56313765 CTGGAACATGATGTTGCCTGTGG + Intronic
932020082 2:68075526-68075548 CTGGAACCAGATGCCTGCTTTGG - Intronic
935460243 2:103322718-103322740 TTGGAAGAAGATGCTATCTAGGG + Intergenic
936750779 2:115639007-115639029 CTGTAGGAAGATGTTGTCTTTGG + Intronic
938210130 2:129460084-129460106 CTGGGAGAAGGTGCTGTCTCAGG + Intergenic
938971786 2:136439469-136439491 CTGGAGCAAGGGGCTGCCTTTGG + Intergenic
939262638 2:139829898-139829920 ATGGAACCAGATGCTCTCTAGGG - Intergenic
941366405 2:164616937-164616959 CTTTTACAAGATGCTGTTTTTGG - Intronic
941917192 2:170820578-170820600 CTGGAACAAGAGAGTGCCTTAGG - Intronic
944201005 2:197107390-197107412 CAGACACCAGATGCTGTCTTTGG + Intronic
944759078 2:202794446-202794468 CTGAACTAAGATGCTGGCTTTGG - Intronic
946498664 2:220222168-220222190 TTGGAAAGAGATGCTCTCTTGGG + Intergenic
1169161034 20:3378643-3378665 ATGGAACTAGATGCTGTCAGAGG + Intronic
1170071377 20:12372801-12372823 CTGGCACAAAAGGCTGTCTATGG + Intergenic
1170598914 20:17825959-17825981 CTGGCAAAAGATGCTGTCTTGGG + Intergenic
1172022962 20:31927509-31927531 CTGGAAATAGATGTTGCCTTTGG + Intronic
1173180668 20:40804233-40804255 TTGGAAGAAGAAGCTGTCTGGGG - Intergenic
1173285876 20:41671101-41671123 CTGAAATAGGAGGCTGTCTTAGG + Intergenic
1173987958 20:47277388-47277410 CTGCAAAAACATGCTGTCATGGG - Intronic
1178806115 21:35841021-35841043 CAGGAAGAAGATGCTGAATTAGG - Intronic
1179578572 21:42322976-42322998 CGGGAACATGGTGTTGTCTTTGG + Intergenic
1182370367 22:29806233-29806255 CTGCAGCAAGCTGATGTCTTCGG + Exonic
1182706768 22:32287251-32287273 GTGGAAGAATATGCTGTGTTTGG - Intergenic
1184395074 22:44230329-44230351 GTGGAAGAATATGCTGTGTTTGG - Intergenic
949634917 3:5972218-5972240 CTGGAACAAAATACTTTGTTAGG + Intergenic
951698386 3:25469349-25469371 CATGAACATGATGCTGTCTTTGG + Intronic
954103856 3:48398541-48398563 CTTGCACAGGATGCTGTCTTTGG + Intronic
954159153 3:48707818-48707840 TTGGAACAATCTGCTGTTTTGGG - Intronic
956916857 3:73880911-73880933 CTGGAATAAGATGCTGGGGTAGG + Intergenic
958784816 3:98586288-98586310 TTGGAATAAGCTGCTGCCTTCGG + Intronic
960293609 3:115915925-115915947 CTAGAACACTATGCTGACTTTGG + Intronic
965149438 3:164951275-164951297 CTGTAACAAAATGAGGTCTTAGG - Intergenic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
966479359 3:180388661-180388683 ATGGAACAATATACTGTTTTGGG - Intergenic
967984462 3:195084917-195084939 CTGGCAGGAGCTGCTGTCTTGGG - Intronic
969068946 4:4515898-4515920 CTGTAATCAGATGCTGTTTTCGG - Intronic
971898043 4:32622075-32622097 CTGGAACTAGAGGCTCTCATGGG - Intergenic
972588583 4:40462021-40462043 CATGAACAAGATTCTGTATTAGG - Intronic
973702393 4:53550298-53550320 CAGGAACAAGATCCAGTCTTGGG - Intronic
975210698 4:71696541-71696563 CTTGTACAAAATTCTGTCTTGGG + Intergenic
975243000 4:72084042-72084064 ATGGAAGATGTTGCTGTCTTAGG - Intronic
976688212 4:87839495-87839517 AAGGAACAAGTTGCTGTCTTCGG + Intronic
978695577 4:111573674-111573696 CTGGAAACAGATACTGTGTTGGG - Intergenic
979535628 4:121817197-121817219 CTGGATCAATTTGCTGACTTGGG - Exonic
980246174 4:130245821-130245843 CTGTATCAAGATGCTGACTGGGG + Intergenic
980993531 4:139759352-139759374 CTGGAACAGGCTGGTGTCTGTGG + Intronic
981628725 4:146792164-146792186 TTGGAAGAAGATGCTATCTAGGG + Intronic
984429844 4:179635159-179635181 ATGGAAAAAGATGTTGTCTCTGG - Intergenic
984685610 4:182665055-182665077 CTGGAAGAAGATGCCATCTAGGG + Intronic
986338443 5:6771298-6771320 CTAGAGCAAGATGCTGTCCTCGG - Intergenic
988216795 5:28285613-28285635 CTGGAAAAAAAAACTGTCTTTGG + Intergenic
989228619 5:39060801-39060823 CTTATACATGATGCTGTCTTTGG + Intronic
990033485 5:51290864-51290886 TTTGAAAAAGATGCTGCCTTTGG - Intergenic
990068444 5:51748172-51748194 CTGGAGGAAGAAGCTGTCTAAGG + Intergenic
991438600 5:66622201-66622223 TTTGAACAAGATGATGTGTTTGG + Intronic
991939810 5:71839702-71839724 ATGTGACAAGATGCTGTCCTTGG + Intergenic
991954222 5:71976328-71976350 ATGGAGGAAGATGCTGTTTTTGG - Intergenic
994162428 5:96571715-96571737 GTGGCACAAGATGCTATTTTTGG - Intronic
995024272 5:107400736-107400758 CTGGAACACCTTGCTGCCTTTGG - Intronic
995716939 5:115089647-115089669 CTGGAACTCTATGCTGACTTAGG + Intergenic
998051797 5:139042100-139042122 CTGGAACAAGAGGATGACTGAGG - Intronic
999658562 5:153834659-153834681 CTGGCACATGATGCTGTGATGGG + Intergenic
1003631081 6:7788154-7788176 CTGGAAGAAGATGGAGTCCTTGG + Intronic
1004616116 6:17291019-17291041 CTGTCACAAGAGGCTGTCGTGGG - Intronic
1006986260 6:38177638-38177660 CTGGGAAGAGATGCTGTCTGTGG + Intronic
1007108823 6:39301361-39301383 CTGGAGAGAGAGGCTGTCTTGGG - Intronic
1007772370 6:44201919-44201941 CTGGAACCACATGCTGGCTCTGG - Intergenic
1007886214 6:45233124-45233146 TTTGTACAAGAGGCTGTCTTTGG + Intronic
1009650508 6:66471322-66471344 ATAGAAAAAGATGCTTTCTTAGG + Intergenic
1009878392 6:69534901-69534923 CAGGAACAGGAAGCTATCTTTGG - Intergenic
1016322812 6:142865906-142865928 CTGTAAGAAGAGGCTGTCTTGGG - Intronic
1016393775 6:143601280-143601302 CTGGAAAAAAAGGCCGTCTTGGG + Intronic
1016785605 6:148007479-148007501 CTGGAAAAAGATGCTCTTATGGG + Intergenic
1018499009 6:164382632-164382654 CTGAAACTAGATCCTCTCTTAGG - Intergenic
1018529115 6:164744116-164744138 CTAGAACAACAGGCTGTCATAGG + Intergenic
1020459643 7:8414136-8414158 TTGAAACAAAATGATGTCTTTGG + Intergenic
1021666293 7:22984210-22984232 CTGGAATTAGATGCTGGCATTGG + Intronic
1023474592 7:40563157-40563179 CTCCAACAAGCTCCTGTCTTTGG - Intronic
1023620492 7:42066915-42066937 ATGGAAGACCATGCTGTCTTTGG + Intronic
1023945450 7:44799265-44799287 ATGGACCAACCTGCTGTCTTTGG - Exonic
1024251300 7:47507770-47507792 CTGGCACAGGAGGCTGTGTTGGG - Intronic
1029634650 7:101775836-101775858 CTGGAAGAAGAGTCTGACTTGGG - Intergenic
1042040675 8:64585670-64585692 CTGGCACATGCTGCAGTCTTAGG - Intergenic
1042462017 8:69080698-69080720 CTGGCGCAAGCTGCTGCCTTAGG + Intergenic
1043722432 8:83562366-83562388 CTGGAAGAAGATGCCATCTAGGG - Intergenic
1045269024 8:100645978-100646000 CTGGAACAAAATCCTGTGTCTGG + Intronic
1046211681 8:111084519-111084541 CTGCAACAAAATACTGTGTTAGG + Intergenic
1047441292 8:124880685-124880707 GTAGAACCAGATTCTGTCTTTGG - Intergenic
1048333104 8:133484556-133484578 CAGGAAGAAGATGCTGTCTCTGG + Intronic
1049312188 8:141939072-141939094 CTGGAATAAAAAGCTGTATTTGG + Intergenic
1049719729 8:144110234-144110256 CTGGAACAGCATTGTGTCTTCGG + Exonic
1050455910 9:5833775-5833797 GTGGAACAGAATGCTGTTTTGGG - Intergenic
1052543238 9:29838247-29838269 TTGGAAGAAGATGCTATCTAGGG - Intergenic
1053278881 9:36803934-36803956 CTGGAAAAAGCTGCTGTGTCTGG + Intergenic
1055890406 9:81117749-81117771 CTGGATCAGGATGCTGTGTTGGG - Intergenic
1058140906 9:101356195-101356217 CAGAAACAAGATGCTATCTATGG - Intergenic
1060121204 9:120991575-120991597 CAGGAACAATTTTCTGTCTTTGG - Intronic
1061993365 9:134172173-134172195 CTTGAAGTAGATGGTGTCTTAGG + Intergenic
1062266227 9:135687691-135687713 CTGGGACAAGATGCTGAGGTTGG - Intergenic
1062645077 9:137543731-137543753 GAGGACCAAGGTGCTGTCTTTGG - Exonic
1185874059 X:3687854-3687876 GAGGAACACGATGCTGTCCTTGG - Intronic
1192774160 X:74224291-74224313 CTGGAAAAAAAAGATGTCTTTGG - Intergenic
1196939094 X:120758244-120758266 CTAGGAAAAGAGGCTGTCTTGGG - Intergenic
1199634088 X:149798930-149798952 ATGGAGCAAGACTCTGTCTTAGG + Intergenic
1199672617 X:150159707-150159729 CAGGGTCAAGATGCTCTCTTTGG - Intergenic
1200607351 Y:5281909-5281931 GTGGAACAGAATGCTGTCATAGG + Intronic