ID: 921106595

View in Genome Browser
Species Human (GRCh38)
Location 1:211987012-211987034
Sequence ATGAGCCACTGTGCCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13468
Summary {0: 8, 1: 244, 2: 1348, 3: 3812, 4: 8056}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921106595_921106602 9 Left 921106595 1:211987012-211987034 CCAGCCTGGGCACAGTGGCTCAT 0: 8
1: 244
2: 1348
3: 3812
4: 8056
Right 921106602 1:211987044-211987066 CCCAGCACTTTGAAAGGGCAAGG 0: 6
1: 274
2: 8003
3: 102087
4: 223477
921106595_921106606 16 Left 921106595 1:211987012-211987034 CCAGCCTGGGCACAGTGGCTCAT 0: 8
1: 244
2: 1348
3: 3812
4: 8056
Right 921106606 1:211987051-211987073 CTTTGAAAGGGCAAGGTGGGTGG 0: 2
1: 90
2: 2502
3: 29774
4: 86449
921106595_921106607 27 Left 921106595 1:211987012-211987034 CCAGCCTGGGCACAGTGGCTCAT 0: 8
1: 244
2: 1348
3: 3812
4: 8056
Right 921106607 1:211987062-211987084 CAAGGTGGGTGGATCACTTGAGG 0: 2569
1: 14350
2: 40057
3: 73907
4: 94464
921106595_921106604 12 Left 921106595 1:211987012-211987034 CCAGCCTGGGCACAGTGGCTCAT 0: 8
1: 244
2: 1348
3: 3812
4: 8056
Right 921106604 1:211987047-211987069 AGCACTTTGAAAGGGCAAGGTGG 0: 2
1: 178
2: 5448
3: 70857
4: 159848
921106595_921106598 3 Left 921106595 1:211987012-211987034 CCAGCCTGGGCACAGTGGCTCAT 0: 8
1: 244
2: 1348
3: 3812
4: 8056
Right 921106598 1:211987038-211987060 TGTAACCCCAGCACTTTGAAAGG 0: 14
1: 1065
2: 26961
3: 324180
4: 259913
921106595_921106599 4 Left 921106595 1:211987012-211987034 CCAGCCTGGGCACAGTGGCTCAT 0: 8
1: 244
2: 1348
3: 3812
4: 8056
Right 921106599 1:211987039-211987061 GTAACCCCAGCACTTTGAAAGGG 0: 1
1: 20
2: 339
3: 2962
4: 3884
921106595_921106605 13 Left 921106595 1:211987012-211987034 CCAGCCTGGGCACAGTGGCTCAT 0: 8
1: 244
2: 1348
3: 3812
4: 8056
Right 921106605 1:211987048-211987070 GCACTTTGAAAGGGCAAGGTGGG 0: 2
1: 116
2: 3368
3: 43250
4: 152773

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921106595 Original CRISPR ATGAGCCACTGTGCCCAGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr