ID: 921106596

View in Genome Browser
Species Human (GRCh38)
Location 1:211987016-211987038
Sequence AGGCATGAGCCACTGTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9394
Summary {0: 139, 1: 602, 2: 1606, 3: 2877, 4: 4170}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921106596_921106607 23 Left 921106596 1:211987016-211987038 CCTGGGCACAGTGGCTCATGCCT 0: 139
1: 602
2: 1606
3: 2877
4: 4170
Right 921106607 1:211987062-211987084 CAAGGTGGGTGGATCACTTGAGG 0: 2569
1: 14350
2: 40057
3: 73907
4: 94464
921106596_921106608 28 Left 921106596 1:211987016-211987038 CCTGGGCACAGTGGCTCATGCCT 0: 139
1: 602
2: 1606
3: 2877
4: 4170
Right 921106608 1:211987067-211987089 TGGGTGGATCACTTGAGGCCAGG 0: 1680
1: 13337
2: 55957
3: 115585
4: 169215
921106596_921106606 12 Left 921106596 1:211987016-211987038 CCTGGGCACAGTGGCTCATGCCT 0: 139
1: 602
2: 1606
3: 2877
4: 4170
Right 921106606 1:211987051-211987073 CTTTGAAAGGGCAAGGTGGGTGG 0: 2
1: 90
2: 2502
3: 29774
4: 86449
921106596_921106602 5 Left 921106596 1:211987016-211987038 CCTGGGCACAGTGGCTCATGCCT 0: 139
1: 602
2: 1606
3: 2877
4: 4170
Right 921106602 1:211987044-211987066 CCCAGCACTTTGAAAGGGCAAGG 0: 6
1: 274
2: 8003
3: 102087
4: 223477
921106596_921106604 8 Left 921106596 1:211987016-211987038 CCTGGGCACAGTGGCTCATGCCT 0: 139
1: 602
2: 1606
3: 2877
4: 4170
Right 921106604 1:211987047-211987069 AGCACTTTGAAAGGGCAAGGTGG 0: 2
1: 178
2: 5448
3: 70857
4: 159848
921106596_921106605 9 Left 921106596 1:211987016-211987038 CCTGGGCACAGTGGCTCATGCCT 0: 139
1: 602
2: 1606
3: 2877
4: 4170
Right 921106605 1:211987048-211987070 GCACTTTGAAAGGGCAAGGTGGG 0: 2
1: 116
2: 3368
3: 43250
4: 152773
921106596_921106598 -1 Left 921106596 1:211987016-211987038 CCTGGGCACAGTGGCTCATGCCT 0: 139
1: 602
2: 1606
3: 2877
4: 4170
Right 921106598 1:211987038-211987060 TGTAACCCCAGCACTTTGAAAGG 0: 14
1: 1065
2: 26961
3: 324180
4: 259913
921106596_921106599 0 Left 921106596 1:211987016-211987038 CCTGGGCACAGTGGCTCATGCCT 0: 139
1: 602
2: 1606
3: 2877
4: 4170
Right 921106599 1:211987039-211987061 GTAACCCCAGCACTTTGAAAGGG 0: 1
1: 20
2: 339
3: 2962
4: 3884

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921106596 Original CRISPR AGGCATGAGCCACTGTGCCC AGG (reversed) Intronic
Too many off-targets to display for this crispr