ID: 921106597

View in Genome Browser
Species Human (GRCh38)
Location 1:211987036-211987058
Sequence TTTCAAAGTGCTGGGGTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 608630
Summary {0: 11, 1: 1021, 2: 26569, 3: 321206, 4: 259823}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921106597_921106610 26 Left 921106597 1:211987036-211987058 CCTGTAACCCCAGCACTTTGAAA 0: 11
1: 1021
2: 26569
3: 321206
4: 259823
Right 921106610 1:211987085-211987107 CCAGGAGTTTCAGACCAGCTTGG 0: 30
1: 1925
2: 29397
3: 119975
4: 216640
921106597_921106607 3 Left 921106597 1:211987036-211987058 CCTGTAACCCCAGCACTTTGAAA 0: 11
1: 1021
2: 26569
3: 321206
4: 259823
Right 921106607 1:211987062-211987084 CAAGGTGGGTGGATCACTTGAGG 0: 2569
1: 14350
2: 40057
3: 73907
4: 94464
921106597_921106606 -8 Left 921106597 1:211987036-211987058 CCTGTAACCCCAGCACTTTGAAA 0: 11
1: 1021
2: 26569
3: 321206
4: 259823
Right 921106606 1:211987051-211987073 CTTTGAAAGGGCAAGGTGGGTGG 0: 2
1: 90
2: 2502
3: 29774
4: 86449
921106597_921106608 8 Left 921106597 1:211987036-211987058 CCTGTAACCCCAGCACTTTGAAA 0: 11
1: 1021
2: 26569
3: 321206
4: 259823
Right 921106608 1:211987067-211987089 TGGGTGGATCACTTGAGGCCAGG 0: 1680
1: 13337
2: 55957
3: 115585
4: 169215
921106597_921106611 27 Left 921106597 1:211987036-211987058 CCTGTAACCCCAGCACTTTGAAA 0: 11
1: 1021
2: 26569
3: 321206
4: 259823
Right 921106611 1:211987086-211987108 CAGGAGTTTCAGACCAGCTTGGG 0: 37
1: 1836
2: 27036
3: 64311
4: 62264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921106597 Original CRISPR TTTCAAAGTGCTGGGGTTAC AGG (reversed) Intronic
Too many off-targets to display for this crispr