ID: 921106606

View in Genome Browser
Species Human (GRCh38)
Location 1:211987051-211987073
Sequence CTTTGAAAGGGCAAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118817
Summary {0: 2, 1: 90, 2: 2502, 3: 29774, 4: 86449}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921106595_921106606 16 Left 921106595 1:211987012-211987034 CCAGCCTGGGCACAGTGGCTCAT 0: 8
1: 244
2: 1348
3: 3812
4: 8056
Right 921106606 1:211987051-211987073 CTTTGAAAGGGCAAGGTGGGTGG 0: 2
1: 90
2: 2502
3: 29774
4: 86449
921106597_921106606 -8 Left 921106597 1:211987036-211987058 CCTGTAACCCCAGCACTTTGAAA 0: 11
1: 1021
2: 26569
3: 321206
4: 259823
Right 921106606 1:211987051-211987073 CTTTGAAAGGGCAAGGTGGGTGG 0: 2
1: 90
2: 2502
3: 29774
4: 86449
921106596_921106606 12 Left 921106596 1:211987016-211987038 CCTGGGCACAGTGGCTCATGCCT 0: 139
1: 602
2: 1606
3: 2877
4: 4170
Right 921106606 1:211987051-211987073 CTTTGAAAGGGCAAGGTGGGTGG 0: 2
1: 90
2: 2502
3: 29774
4: 86449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921106606 Original CRISPR CTTTGAAAGGGCAAGGTGGG TGG Intronic
Too many off-targets to display for this crispr