ID: 921108260

View in Genome Browser
Species Human (GRCh38)
Location 1:212005841-212005863
Sequence GTCACAGATATCCCAAGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921108260 Original CRISPR GTCACAGATATCCCAAGATA AGG (reversed) Intronic
900748149 1:4375363-4375385 GTCATAGATATACCCTGATATGG - Intergenic
902939013 1:19786340-19786362 GTCAGAGGGATCCCAAGATGGGG + Intronic
904030271 1:27529118-27529140 GGCACAGAGATGCCAAGATCCGG + Intergenic
907703808 1:56815480-56815502 TTCTCAGAAATTCCAAGATAGGG + Intronic
908261666 1:62343889-62343911 GTCACAGACTGCCCAAGACATGG - Intergenic
911033846 1:93517519-93517541 GTAACAGAAAACCCAAGAGAAGG - Intronic
914325290 1:146608728-146608750 GACACAGATATTCTAAAATATGG - Intergenic
915905548 1:159874263-159874285 GTCACCGATACCCCAACAAAAGG + Intronic
918621677 1:186612783-186612805 TTCACAGGTAACCCAAGATCTGG - Intergenic
921094118 1:211872494-211872516 GTTACAGTTATCCCCAGGTATGG - Intergenic
921108260 1:212005841-212005863 GTCACAGATATCCCAAGATAAGG - Intronic
1063585500 10:7348995-7349017 GTCACAGAGATCCCAGGTCAAGG + Intronic
1065070245 10:22015743-22015765 GAAACAGATATCCCAAAATATGG - Intergenic
1065963685 10:30754110-30754132 GTCACAGCTATCTGGAGATAAGG - Intergenic
1066102879 10:32133486-32133508 GTCCCAGATTTACCAAGCTAAGG + Intergenic
1066452362 10:35542237-35542259 GTCAGACAAATCCCAAGTTAGGG - Intronic
1067192152 10:44080644-44080666 GCCTCATATATCCCAAGATTAGG - Intergenic
1068363046 10:56005443-56005465 ATCAAAGAAATCCCAATATAGGG + Intergenic
1069179470 10:65340005-65340027 AACACAGATTTTCCAAGATACGG - Intergenic
1070666936 10:78351575-78351597 GACACAGAGATCACAAGAGAGGG + Intergenic
1071082147 10:81825168-81825190 GAAACAGATATGCCAAAATATGG - Intergenic
1073513477 10:104057157-104057179 TTCACAGATATCCACAGCTACGG - Exonic
1073802765 10:107060639-107060661 GTCACAAATATCACAAAGTAAGG - Intronic
1076350235 10:129810601-129810623 CTCACAGTAATCCCAAGAGATGG + Intergenic
1084136052 11:67183051-67183073 GTCACAGATATCCCAGGTAGAGG + Intronic
1085691860 11:78670734-78670756 GTTACAGATGTGCCAAGATGAGG + Intronic
1085860796 11:80232989-80233011 CTAACAGATATTCCAAGAGAAGG + Intergenic
1087898015 11:103609393-103609415 GTCCCAGATCTCCAAAGAGAGGG + Intergenic
1090928595 11:131275255-131275277 CACATAGAAATCCCAAGATATGG + Intergenic
1092470110 12:8770527-8770549 CTAACAGAGATCTCAAGATATGG - Intronic
1096572568 12:52532163-52532185 GTCAAATATTTCCCAAGCTACGG + Intergenic
1101256020 12:102977624-102977646 GTCATATATATCCCAAGCTTTGG + Intergenic
1104853387 12:131889822-131889844 GTAATTGATATCCCAAAATAGGG - Intergenic
1107199548 13:37697595-37697617 TTCATACATATCCCAAAATATGG - Intronic
1109369676 13:61406549-61406571 GTGACAGATATTCCAATATGAGG - Intergenic
1109479728 13:62934063-62934085 TACACAGCTATCCCAAGGTAGGG - Intergenic
1111084095 13:83351453-83351475 GTCACAGTTTTCCAAAGAGAAGG - Intergenic
1112149287 13:96739435-96739457 GTCTCTGATATCCTAAGATTGGG - Intronic
1114674978 14:24434102-24434124 GTCACAGATTACCCAAGATATGG + Intronic
1117722694 14:58642859-58642881 TGCAAAGATATCCCAAAATAAGG - Intronic
1119425053 14:74529560-74529582 GACAGAGATGACCCAAGATAGGG - Intronic
1122529904 14:102418283-102418305 TTCACAGATATCCCCCGATGAGG - Intronic
1128352128 15:66898126-66898148 GTCCCTGATATCCCCAGACATGG + Intergenic
1133971672 16:10572621-10572643 GTCACAGAACTCCCAAGTTCAGG + Intronic
1140008271 16:71102219-71102241 GACACAGATATTCTAAAATATGG + Intronic
1140794022 16:78418486-78418508 GACAAAGATATCACAAGAAAAGG + Intronic
1140949247 16:79800318-79800340 GTCACATACATTTCAAGATAGGG - Intergenic
1141541824 16:84729355-84729377 GTCATCGATATCACAAGCTAGGG - Intronic
1145358831 17:22193213-22193235 TACACAGCTATCCCAAGGTACGG + Intergenic
1149284764 17:55150238-55150260 CTCACAGAAGTCCCAAGATCAGG + Intronic
1152445098 17:80337826-80337848 TTCACAGATTTCCCCAGACACGG + Exonic
1158385008 18:56979608-56979630 GTGACAGAGATCCAGAGATAGGG - Intronic
1161126583 19:2561250-2561272 GCCACAGATGTCCCCAGACATGG - Intronic
1161572398 19:5037765-5037787 GCCACAGACATCCCCAGACATGG + Intronic
1161582678 19:5089357-5089379 GCTACAGATATCCCTAGACATGG - Intronic
1162534393 19:11254252-11254274 GTCACAGAGATCCTGAGATGAGG + Intronic
1165560336 19:36673882-36673904 GTCACAGAGTTCCTAAGAGAAGG + Intergenic
1165942363 19:39421300-39421322 GTAAGAGATATCTCGAGATAGGG + Intronic
1167338049 19:48898616-48898638 TTCGCAGATATCCCGAGATTAGG - Exonic
1167889563 19:52528464-52528486 GTGAGGGATATGCCAAGATATGG + Intronic
1168123677 19:54271013-54271035 TTCACAGAGATCCCAAGGTGGGG - Intronic
1168178675 19:54644508-54644530 TTCACAGAGATCCCAAGGTGGGG + Intronic
925131315 2:1496051-1496073 GTCACAGATGACCCGAGACAGGG - Exonic
928985706 2:37179499-37179521 GTCCCCGATATTCCAAGCTATGG - Exonic
930682295 2:54269470-54269492 GACACTGATATCCCAGAATAAGG + Intronic
932114385 2:69033131-69033153 GTCACAGAGACCCCAGGACAGGG - Intronic
932192089 2:69749389-69749411 GAAACTGATATCCCAAAATATGG - Intronic
935228858 2:101078680-101078702 TTCAAAGATGTCCCAAAATAGGG - Intronic
935417591 2:102835080-102835102 CTCACAGAAAACCCAAGATCAGG + Intronic
935712563 2:105912307-105912329 GTCACAGTTCTCCAAAGAAACGG - Intergenic
939196697 2:138981674-138981696 GTCACAGAGAGCACAAGGTATGG - Intergenic
941115158 2:161463513-161463535 CTTACAGATGTACCAAGATAAGG - Intronic
943271904 2:185816252-185816274 AAAACAGATATCCCAAAATAAGG - Intronic
943857017 2:192808676-192808698 CTCACAGATAGTCCAAGGTAGGG - Intergenic
945558567 2:211309359-211309381 GTCACAGAGATGACAAGAAAAGG - Intergenic
945621370 2:212143560-212143582 GTCACAGCCATACCAAGGTAAGG - Intronic
948441907 2:237997370-237997392 TTCACAGACATCACAAAATAAGG - Intronic
1169614766 20:7428109-7428131 GTCACACAAATCCAAAGAAAAGG - Intergenic
1172371441 20:34395478-34395500 GAAACTGATATCCCAAAATATGG - Intronic
1173467877 20:43298340-43298362 CTCTCAGATATGCCAAGACAGGG - Intergenic
1174250631 20:49216990-49217012 GGCACAGATCTCCAAAGAGATGG + Intergenic
1179013920 21:37578212-37578234 GACACAAATATCACAATATATGG - Intergenic
1184365141 22:44046405-44046427 GTCAGTGATATCCCATGATGAGG - Intronic
949956077 3:9269689-9269711 GAAACAGTTATCCCAAGAGAGGG + Intronic
950635922 3:14314546-14314568 GAAACAGATACCCCAAAATATGG + Intergenic
952441208 3:33331321-33331343 GTTACAGGTATCCTAAGATTAGG + Intronic
952499700 3:33949239-33949261 TTCTCAGATATCCCCAGGTAAGG - Intergenic
955971034 3:64438822-64438844 GTCACTGACATGCCAAGAAATGG - Intronic
956297538 3:67730451-67730473 CTCAGAGTTATCCCAAGCTAAGG + Intergenic
956903615 3:73742536-73742558 GGCACAGAGGTCCCCAGATATGG - Intergenic
963367671 3:144358754-144358776 GTCACAGATATCCAAGATTAGGG + Intergenic
964766785 3:160187138-160187160 GTAACAGAAATCCCAAGTTCTGG + Intergenic
964793907 3:160477693-160477715 GACACAGAGGTCCCAAGGTAAGG + Intronic
966036447 3:175422941-175422963 GTCACAGAAATTAGAAGATAGGG + Intronic
969087273 4:4665839-4665861 GACACAGACATCCCCAGACATGG + Intergenic
969244905 4:5925680-5925702 GTCACAGAAATGCCCAGACATGG + Intronic
969915397 4:10485797-10485819 TTCACAATTATTCCAAGATATGG - Intergenic
970662014 4:18295932-18295954 GTTACAGAAATCCTAAGAAATGG - Intergenic
975358421 4:73436138-73436160 GTAACAGATATACCAACAAAAGG + Intronic
975474383 4:74806275-74806297 CTCAAAGTTATCCCAAGATTTGG + Intergenic
975979119 4:80135598-80135620 CTGACAGATATCCAAAGATAAGG - Intergenic
976937305 4:90652477-90652499 GAAACTGATATCCCAAAATATGG + Intronic
978435906 4:108684356-108684378 GTTATAGATGTCCCAAGACAGGG + Intergenic
979581974 4:122371456-122371478 ATCACAGAAATCCCAGGAAAAGG + Intergenic
982703977 4:158687384-158687406 GAAACCGATATCCCAAAATATGG - Intronic
983695383 4:170522288-170522310 GTCACAGTTCTCCAAAGAAACGG - Intergenic
986878498 5:12140251-12140273 GTCAGAGATCTCACAATATAGGG - Intergenic
988713615 5:33803020-33803042 GTCACTGATATTATAAGATAAGG + Intronic
991114320 5:62936494-62936516 GTCACAAATTTAACAAGATAAGG + Intergenic
991431998 5:66558077-66558099 GTATCAGATATCGCAAGCTAGGG - Intergenic
992449472 5:76862899-76862921 GTCACAGATTTCTTAAGAGAAGG - Intronic
992892548 5:81217375-81217397 GTCAAGTACATCCCAAGATAAGG - Exonic
993788523 5:92176157-92176179 ATGACAGATATACCAAAATAAGG + Intergenic
995942644 5:117602466-117602488 GTGACAGGTATGCCAAGATATGG - Intergenic
997042177 5:130269998-130270020 GTATCACATATCCCAAAATATGG - Intergenic
997621991 5:135305161-135305183 GGCACAGGTATCCCAGGAGAAGG - Intronic
1000053211 5:157579898-157579920 GAAACCAATATCCCAAGATATGG + Intergenic
1004239410 6:13905645-13905667 GTCAAAGATATCACAATAAATGG - Intergenic
1004239478 6:13906715-13906737 GTCAAAGATATCACAATAAATGG - Intergenic
1004278129 6:14256087-14256109 GTAACAGAGATCACCAGATAAGG + Intergenic
1005189273 6:23201279-23201301 GTCAAAGATATCCACAGAGATGG - Intergenic
1008075304 6:47139425-47139447 TTCACAGCTATCCCAAGAGAGGG + Intergenic
1008098195 6:47361639-47361661 GTCTCACATATCCCAAGGCAAGG + Intergenic
1012681758 6:102191635-102191657 GTCACAGAAACACCAATATATGG - Intergenic
1015338643 6:132071673-132071695 GTCTGAGAAAGCCCAAGATAAGG - Intergenic
1015879168 6:137853793-137853815 GTCACACATAGTCCAGGATATGG + Intergenic
1017591468 6:155982472-155982494 GATACAGATATCAAAAGATAAGG + Intergenic
1019887381 7:3917426-3917448 GTGACAGATTCCCCAAGACACGG + Intronic
1024169391 7:46768491-46768513 GAAACAGACATCCCATGATAGGG - Intergenic
1027615662 7:80420749-80420771 GTCACATATTTCCAATGATAAGG + Intronic
1029975842 7:104832586-104832608 GTCAGAGAGATCCTAAGACAAGG - Intronic
1031821446 7:126506982-126507004 GTCACAGATATGCAAGGAGAGGG + Intronic
1032022163 7:128413757-128413779 GGCACAGACCTCCCAAGCTAGGG + Intergenic
1033242193 7:139689729-139689751 GGCTCAGAAATCCCAAGCTATGG + Intronic
1036546930 8:9780299-9780321 GTCACAGATATCACACAAGAGGG - Exonic
1038424423 8:27455224-27455246 GTCACAGGGATCCCAGGATCAGG + Intronic
1038704595 8:29881701-29881723 CTCACAGCTATCCCAGGATGGGG + Intergenic
1040049934 8:43004033-43004055 GCCACAGATATCTCCAAATATGG + Intronic
1043590566 8:81828365-81828387 ATCACAGATACTCCAAGAAAAGG - Intronic
1043733739 8:83718318-83718340 AGCACAGATATCTCAATATATGG + Intergenic
1044368495 8:91378840-91378862 GTTACAGATTTCCAAATATATGG - Intronic
1045194054 8:99912077-99912099 TTCACAGATATGCCCAGAAAGGG + Intergenic
1047652131 8:126934162-126934184 GCCACAGATACTCCAAGCTAAGG + Intergenic
1051909505 9:22137424-22137446 CTTACAGTTATGCCAAGATAGGG + Intergenic
1055815856 9:80205248-80205270 ATCACAGATATCACAAAATCGGG + Intergenic
1056676605 9:88681640-88681662 GTCACAGACACACCAAGACAGGG - Intergenic
1056944886 9:90985739-90985761 GTGAGACATCTCCCAAGATAAGG - Intergenic
1057695852 9:97322650-97322672 GTTCCTGACATCCCAAGATAAGG - Intronic
1060686029 9:125613475-125613497 TTCACAGTTGTCCCAAGTTAGGG - Intronic
1061079742 9:128362710-128362732 TTCACAACTATCCCAAGATAGGG - Intergenic
1062142149 9:134965429-134965451 TTCACAGAAATTCTAAGATATGG + Intergenic
1187530502 X:20092272-20092294 GAAGCAGATATCCCAAAATATGG + Intronic
1192540185 X:71962274-71962296 GCCAAAGATATCACAAGAAAAGG - Intergenic
1193419982 X:81271445-81271467 GTGACAGATGTTCCAAGATGTGG - Intronic
1194273508 X:91850940-91850962 GTCACAAATATCAAAAGATGTGG - Intronic
1195284503 X:103370825-103370847 GAAACTGATACCCCAAGATATGG - Intergenic
1196071530 X:111528815-111528837 GTGACAGATTCCCCAAAATAGGG + Intergenic
1200441452 Y:3216864-3216886 GAAACTGATATCCCAAAATATGG + Intergenic
1200590753 Y:5072360-5072382 GTCACAAATATCAAAAGATGTGG - Intronic
1200695530 Y:6355346-6355368 CTCACAAATATCCTTAGATAAGG + Intergenic
1201039747 Y:9819364-9819386 CTCACAAATATCCTTAGATAAGG - Intergenic
1202198861 Y:22326154-22326176 CTCACAGCTATCCTTAGATAAGG + Intronic