ID: 921108295

View in Genome Browser
Species Human (GRCh38)
Location 1:212006353-212006375
Sequence ATTGAGAAGCCCAATTACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921108295_921108296 -3 Left 921108295 1:212006353-212006375 CCAATGTAATTGGGCTTCTCAAT 0: 1
1: 0
2: 0
3: 8
4: 114
Right 921108296 1:212006373-212006395 AATTAGCCTTAGTGCCACTATGG 0: 1
1: 0
2: 0
3: 5
4: 78
921108295_921108300 21 Left 921108295 1:212006353-212006375 CCAATGTAATTGGGCTTCTCAAT 0: 1
1: 0
2: 0
3: 8
4: 114
Right 921108300 1:212006397-212006419 AGAATGAACAAGCAACTGAGTGG 0: 1
1: 0
2: 1
3: 23
4: 283
921108295_921108297 -2 Left 921108295 1:212006353-212006375 CCAATGTAATTGGGCTTCTCAAT 0: 1
1: 0
2: 0
3: 8
4: 114
Right 921108297 1:212006374-212006396 ATTAGCCTTAGTGCCACTATGGG 0: 1
1: 0
2: 0
3: 3
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921108295 Original CRISPR ATTGAGAAGCCCAATTACAT TGG (reversed) Intronic
903822706 1:26114968-26114990 AAAGAGATGCCCAATTACCTAGG - Intronic
905384903 1:37595800-37595822 ATGGTGAAGCCCAAGTACAAAGG - Exonic
907073895 1:51561990-51562012 ATTGAAAATCCCAATTACCAGGG - Intergenic
908251138 1:62266987-62267009 ATTCAGAAGCCAAGTCACATCGG - Intronic
909527878 1:76647276-76647298 ATTGAGAATCCCAGACACATTGG + Intergenic
910044512 1:82895429-82895451 ATTGAGAAGTACAATTACTGAGG + Intergenic
913675417 1:121136188-121136210 AATGAGAAGCCAAATCAGATAGG - Intergenic
914027311 1:143924129-143924151 AATGAGAAGCCAAATCAGATAGG - Intergenic
917065889 1:171092749-171092771 TTTGAGAAGAGCAATGACATTGG + Exonic
917974043 1:180228091-180228113 ATTATGAAACCCAATAACATGGG - Intergenic
918497304 1:185155795-185155817 ATTCAGAAGCACAATAATATGGG + Intronic
920462782 1:206155025-206155047 AATGAGAAGCCAAATCAGATAGG - Intergenic
921108295 1:212006353-212006375 ATTGAGAAGCCCAATTACATTGG - Intronic
923398989 1:233597605-233597627 ATGAAGAAGCCCAATTATCTGGG + Intergenic
924917426 1:248586284-248586306 TTTGACATGCCCAATTAAATTGG - Intergenic
1065672793 10:28139632-28139654 ATTGTGAAGCCCTATTAAGTAGG - Intronic
1068247269 10:54389346-54389368 ATTGAGAAGCCCTATTTTAGAGG - Intronic
1079421097 11:20289345-20289367 ATTTTGAAGATCAATTACATAGG - Intergenic
1080990814 11:37532497-37532519 ATAGAGAAGCACAAAGACATGGG - Intergenic
1081399548 11:42626862-42626884 ATTGAAAACCGCAATTACATTGG - Intergenic
1082989184 11:59192645-59192667 ATTGGGAAACCCATTTACAATGG - Intronic
1089035841 11:115390308-115390330 CTGGACAAGCCCAATTATATTGG + Intronic
1091224478 11:133949500-133949522 ATAGAGAAACCCAAATACAGGGG + Intronic
1092695467 12:11166628-11166650 CTGGAGAAGCCCATTTACACTGG - Intronic
1095956148 12:47807508-47807530 ATTCTGAAGCCCAATTGCCTGGG - Intronic
1099271522 12:80516637-80516659 ATTCAGAAGTCCATTTACAAAGG - Intronic
1101265815 12:103085861-103085883 ATTCAGCAGCCTAATTACAAAGG + Intergenic
1105748188 13:23396989-23397011 ATTAACAAGCCTAAATACATAGG - Intronic
1107598040 13:41984188-41984210 ATTAAGAATCCCTTTTACATTGG - Intergenic
1111065230 13:83082360-83082382 AATTAGAAGTGCAATTACATTGG - Intergenic
1111860483 13:93698752-93698774 ATTGTGAAAGCCAAATACATTGG - Intronic
1114620288 14:24092329-24092351 ATTGAGAAGTACAATTCCAAAGG + Intronic
1115785282 14:36818533-36818555 AGTGAGAGGCCCCATTACACAGG + Intronic
1115910105 14:38246665-38246687 ATTTAGCAGCTCATTTACATTGG - Intergenic
1118155837 14:63240789-63240811 CTTGAGAAACCTAATTTCATGGG - Intronic
1118865462 14:69699888-69699910 CTTGAGGAGACCATTTACATAGG + Intronic
1120337965 14:83183055-83183077 TTTGAGAAACTCATTTACATAGG + Intergenic
1125771875 15:42173521-42173543 ATTGAGAAGACCAGATTCATAGG + Intronic
1128352479 15:66900391-66900413 ATTGAGAAGCCAGATTATTTGGG + Intergenic
1128808709 15:70554511-70554533 GTTGAGAATCCCAAGTGCATTGG + Intergenic
1140198862 16:72878426-72878448 ATTGAGAAGCCCCACAGCATGGG - Intronic
1143890926 17:10101826-10101848 ACTGAGAAGCCAACTTAGATGGG - Intronic
1144031981 17:11331395-11331417 ATTCTGAAGTCCAATTAAATAGG + Intronic
1146233505 17:31134749-31134771 ATGGAGAAGCCCAAGTAGAAAGG - Intronic
1149724957 17:58883825-58883847 ATTGGGAAGCCTAAGTACATGGG + Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1155134555 18:22976217-22976239 ATTCAGTAGACCAATCACATGGG - Intronic
1156071420 18:33215754-33215776 ATTTAGGAACACAATTACATTGG + Intronic
926820973 2:16851561-16851583 AGTCAGAAGTCCAAATACATTGG + Intergenic
926875399 2:17471164-17471186 ATGGAGAAGCCAAATTAAAGTGG - Intergenic
929042116 2:37754847-37754869 TTTGAGAAGCCCAAGTCTATAGG - Intergenic
937002854 2:118484135-118484157 ATGCAGAAGACCATTTACATCGG - Intergenic
937540034 2:122938105-122938127 ATAGAATAGCCCAAATACATAGG + Intergenic
939095695 2:137830924-137830946 AAGGAGAAGCCCAAATTCATGGG - Intergenic
940157757 2:150677254-150677276 TTTGAGAATACCAATTACAGGGG + Intergenic
941358894 2:164527687-164527709 TTTAAGAAGCCCAATTCCTTGGG + Intronic
941414165 2:165198333-165198355 ATTTAGAAGCACAGCTACATTGG - Intronic
944020738 2:195100603-195100625 ATGGAGAAGGCCAATCACAGTGG + Intergenic
1178329740 21:31677500-31677522 GTTCAAAAGCCCAGTTACATAGG - Intronic
1179350677 21:40607894-40607916 ATTGAGAGGCGCCATTCCATAGG + Intronic
1180895046 22:19324891-19324913 CTTGAAAAGAACAATTACATTGG + Intergenic
1183816917 22:40309780-40309802 AATGACAAGCTCAATTACTTTGG - Intronic
1203294324 22_KI270736v1_random:26349-26371 TCTGAGAAGCCCAAGTATATAGG - Intergenic
949190917 3:1247899-1247921 AGTGAGATGCCCAGTGACATTGG - Intronic
960433405 3:117597413-117597435 ATTGTGAAGCCAGACTACATGGG - Intergenic
960627412 3:119694649-119694671 ATTGAAAAGTCCAAATGCATTGG - Intergenic
962377473 3:134870478-134870500 ATTCAGAAGCCCACTTAGAAAGG + Intronic
963969578 3:151414622-151414644 ATTGGGAAGCCCAGTTCCAGAGG - Intronic
967043657 3:185717036-185717058 ATTGAGAGGCCCAGTTCCATGGG - Exonic
967674820 3:192284464-192284486 ATTGGGAAGCCAAATTGCAAAGG - Intronic
971114122 4:23623549-23623571 ATTGAGACTCCAAAATACATAGG + Intergenic
972293860 4:37717687-37717709 ATGGAGAAGCCCATGTGCATAGG + Intergenic
981263393 4:142750694-142750716 ATTGAGGGGTCCAATTACAAGGG + Intronic
983822856 4:172217947-172217969 TTAGAGAAGCCCAAATACAAAGG - Intronic
984515973 4:180739785-180739807 TTTGTGAAGCCCCATTACATAGG + Intergenic
987276431 5:16368014-16368036 TTTGAGAAGCACAATTTCCTGGG - Intergenic
990516990 5:56539482-56539504 ATTTAGAAGTCCAAATCCATTGG + Intronic
991745593 5:69737491-69737513 ATTGAGTAGCCCAAAGACAGAGG + Intergenic
991752113 5:69817742-69817764 ATTGAGTAGCCCAAAGACAGAGG - Intergenic
991797160 5:70317244-70317266 ATTGAGTAGCCCAAAGACAGAGG + Intergenic
991824971 5:70612805-70612827 ATTGAGTAGCCCAAAGACAGAGG + Intergenic
991831433 5:70692847-70692869 ATTGAGTAGCCCAAAGACAGAGG - Intergenic
991889539 5:71316777-71316799 ATTGAGTAGCCCAAAGACAGAGG + Intergenic
993122118 5:83788401-83788423 TTTAAGAAGCTCACTTACATAGG - Intergenic
1002511341 5:179720498-179720520 ATTGACAACCCCAATTATAAAGG + Exonic
1005556259 6:26987956-26987978 ATTGAGTAGCCCAAACACAAAGG + Intergenic
1005748639 6:28863353-28863375 ATTAACAAGCCCAATCACATTGG - Intergenic
1007050750 6:38826158-38826180 ATGGATAAGGCCAATTTCATCGG - Exonic
1007804147 6:44425581-44425603 ACTGAAAAGCACATTTACATGGG - Intronic
1013597300 6:111671905-111671927 ATTCACAAACCCAATTAAATAGG + Intronic
1015241357 6:131027099-131027121 ATTGAGCAGGCAAAATACATTGG + Intronic
1017570526 6:155739855-155739877 CTTGAGAAGCTGAATTTCATTGG - Intergenic
1021246601 7:18270463-18270485 ATAGAAAAGGCCAAGTACATTGG + Intronic
1022374975 7:29804785-29804807 ATTCATAAGCCCTCTTACATGGG - Intergenic
1023094665 7:36648270-36648292 TTTGTGAAGTCCAAATACATAGG + Intronic
1023189312 7:37562323-37562345 ATTTAGAATACCAATTAGATGGG - Intergenic
1024192605 7:47028011-47028033 TTTAAAAAGCCCAATTATATTGG - Intergenic
1024385909 7:48751358-48751380 TTTGAGCAGCCCAAGTACACAGG - Intergenic
1026325042 7:69301824-69301846 ATTGAATAGCCCCATTTCATGGG - Intergenic
1029376081 7:100177614-100177636 ATTGAGAAGCCAGATTAAAGGGG + Exonic
1034123969 7:148654465-148654487 TTTGACATTCCCAATTACATAGG - Intergenic
1038232741 8:25718816-25718838 ATTGAGATACCCAACAACATGGG - Intergenic
1042791750 8:72615405-72615427 ACTGAGAAGCCAAACTACAGAGG - Intronic
1042792334 8:72622295-72622317 ATTGAGAAGACTAGTTACAGAGG - Intronic
1043146837 8:76669178-76669200 ATTGATAAGAACATTTACATGGG - Intergenic
1043607044 8:82013729-82013751 ATTGAGAAGCTAAATACCATAGG + Intergenic
1044115574 8:88329031-88329053 ATTGACAAGGCAAATTTCATGGG + Intergenic
1046726956 8:117686211-117686233 ATTCTGAAGCCCAACTACATGGG - Intergenic
1047294317 8:123557770-123557792 AAAGAGAAGCCCAATTTCACTGG + Intergenic
1051696631 9:19774801-19774823 ATTAAGAAACCCAATTAAAGAGG - Intronic
1052373231 9:27689478-27689500 ACTGAGAAGCCCAATTTCAAAGG - Intergenic
1055240843 9:74183800-74183822 ATTTAGAAGCCAAATTGCCTGGG + Intergenic
1056347230 9:85709468-85709490 ATTGAGCAGCTGAATGACATTGG - Intronic
1059809898 9:117844516-117844538 AAAGAGAAGCCCAATAACCTGGG + Intergenic
1060866787 9:127006718-127006740 ACTGAGCAGCCCTATTACCTTGG - Intronic
1188632240 X:32378334-32378356 CTTGAGAAGCCTAAATAAATTGG - Intronic
1190489873 X:50970938-50970960 ATAGAAAAGCCCAAATAAATAGG + Intergenic
1191014805 X:55797801-55797823 ATTGAGAAGCCAGGTCACATGGG - Intergenic
1195961616 X:110393153-110393175 ATTGTGAAGTCCAACTACATGGG + Intronic
1196770958 X:119292715-119292737 ATAGAGAAGCCCAAGAAGATAGG + Intergenic
1197352849 X:125399433-125399455 ATTGATTAGCCTAAATACATGGG - Intergenic
1199786006 X:151105458-151105480 ATTGGGAAGCCAGATCACATAGG - Intergenic
1201361905 Y:13161181-13161203 AGAGAGAACGCCAATTACATGGG + Intergenic