ID: 921111077

View in Genome Browser
Species Human (GRCh38)
Location 1:212037344-212037366
Sequence ATGGAACACCAACACTGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921111077_921111083 13 Left 921111077 1:212037344-212037366 CCTCTTCAGTGTTGGTGTTCCAT 0: 1
1: 0
2: 2
3: 26
4: 168
Right 921111083 1:212037380-212037402 TCTTCTTCTACCTACTCCTTTGG 0: 1
1: 0
2: 4
3: 28
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921111077 Original CRISPR ATGGAACACCAACACTGAAG AGG (reversed) Intronic
900730325 1:4254634-4254656 CAGAAACACCATCACTGAAGAGG - Intergenic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
904292899 1:29499065-29499087 AGGGAAAACCAGCACTGATGTGG + Intergenic
904526886 1:31140503-31140525 ATGGATGAACAAGACTGAAGAGG + Intergenic
904586263 1:31582612-31582634 ATGGAGCACCCACAGTGAGGAGG + Intronic
905489507 1:38332540-38332562 GAGGATCACCAACAATGAAGGGG - Intergenic
906455182 1:45989460-45989482 ATGAAACAACATCACTGAAGAGG - Intronic
906532669 1:46532602-46532624 AAGGAGCACCCACCCTGAAGGGG - Intergenic
907186359 1:52612411-52612433 ATGGAAGACCAACAGGGAAGGGG - Intergenic
908759939 1:67502383-67502405 CTGGAACACCAGGACTGAAAAGG - Intergenic
909306917 1:74093209-74093231 ATGAAACTCCAACACTCAGGAGG + Intronic
911143255 1:94528391-94528413 ATGGCACACCTACTCAGAAGTGG - Intergenic
913028007 1:114865467-114865489 TTGGAACACCCACAATGAAAAGG - Intronic
916434399 1:164763783-164763805 AAGCAACAGCAACACTGAAAAGG + Intronic
916756954 1:167780208-167780230 ATAGAACACAAATAATGAAGTGG + Intronic
917146082 1:171893119-171893141 ATGAAACAACCTCACTGAAGGGG - Intronic
917952283 1:180051707-180051729 ATGGCATAACAACATTGAAGGGG + Intronic
919318105 1:196000297-196000319 AGCAAAGACCAACACTGAAGTGG + Intergenic
920264974 1:204715035-204715057 ATGGAAATCCAACCTTGAAGTGG - Intergenic
920935001 1:210424196-210424218 AAGAAATACGAACACTGAAGAGG - Intronic
921063997 1:211609874-211609896 AGGGAACAGCAACGGTGAAGAGG - Intergenic
921111077 1:212037344-212037366 ATGGAACACCAACACTGAAGAGG - Intronic
1065928128 10:30454224-30454246 ATTGAACACCAAGACTGACCTGG - Intronic
1071419080 10:85471630-85471652 ATGTTACAACAACACAGAAGGGG + Intergenic
1072123341 10:92423436-92423458 ATGAAACACCATCTCGGAAGCGG + Intergenic
1074160378 10:110831784-110831806 CTGGAACAACAACAGTAAAGTGG + Intronic
1079677008 11:23241448-23241470 ATGTAACACCAAAATTTAAGGGG - Intergenic
1080985879 11:37464879-37464901 ATCGAAGACGTACACTGAAGAGG - Intergenic
1086494031 11:87384362-87384384 TTGGAGCACCCACTCTGAAGTGG + Intergenic
1086640288 11:89146071-89146093 AAGGAACAGCAACCCTGAAAAGG + Intergenic
1087624678 11:100582998-100583020 GGGGAACACCAACATTTAAGGGG - Intergenic
1092912842 12:13163515-13163537 ATGGAACATCAACATTGCAGAGG + Intergenic
1094097845 12:26727995-26728017 CAGGAAAACCACCACTGAAGCGG + Intronic
1094387340 12:29909601-29909623 CTGAAACTCCAACAATGAAGAGG + Intergenic
1094480306 12:30876146-30876168 GTGGATCACCAACACGGAAGGGG + Intergenic
1097511338 12:60545755-60545777 ATGAAACAGCCTCACTGAAGTGG + Intergenic
1097581938 12:61468603-61468625 ACAGAACTCCAACACAGAAGAGG - Intergenic
1097686543 12:62696389-62696411 ATTGAAAACCAACACTGGCGGGG - Intronic
1097978197 12:65710084-65710106 AGGAAACATCCACACTGAAGGGG - Intergenic
1101338658 12:103820904-103820926 ATGGCACAGCCACACTGGAGGGG - Intronic
1106442583 13:29790549-29790571 CTGGAACACCAACCCCCAAGAGG + Intronic
1106875717 13:34070415-34070437 ATGAAACACCAAAGCAGAAGGGG + Intergenic
1107236923 13:38182223-38182245 ATGGGACAGCCTCACTGAAGTGG + Intergenic
1108536186 13:51382080-51382102 AAGCAAAACCAACATTGAAGTGG - Exonic
1109476878 13:62891000-62891022 AAGGAACACCAAATCTGGAGTGG + Intergenic
1110373496 13:74765956-74765978 AAGGAACAGCGACACTGGAGTGG + Intergenic
1112100863 13:96187746-96187768 ATGGAACACCAACACGGCATTGG - Intronic
1112951496 13:105002852-105002874 ATGCAACACCAAAAATGAAAAGG - Intergenic
1114813188 14:25925385-25925407 ATTCAAGATCAACACTGAAGTGG - Intergenic
1115188556 14:30721083-30721105 AAGGAACTGGAACACTGAAGAGG + Intronic
1115480020 14:33851482-33851504 ATGGAGCCCCAAGGCTGAAGTGG + Intergenic
1115493174 14:33978547-33978569 ATAGGACACCACCACTTAAGGGG - Intronic
1117198974 14:53369111-53369133 ATGGATGACTTACACTGAAGTGG + Intergenic
1117267637 14:54106509-54106531 AGGGATCACAAACACTGATGAGG + Intergenic
1117428354 14:55624679-55624701 AGGAAACACCAACAATGAAAGGG + Intronic
1119430633 14:74566266-74566288 AGGGAACACCAACGCTTAAGAGG + Intronic
1120345465 14:83284027-83284049 ATGGAAAACAAATATTGAAGTGG + Intergenic
1124716493 15:32067738-32067760 ATGCAACAACAACACAGAGGAGG + Intronic
1126730075 15:51673588-51673610 CTGGAAAGCCAACTCTGAAGTGG - Intergenic
1127169251 15:56281993-56282015 ATAGAACATCAACATTTAAGGGG - Intronic
1130835318 15:87644549-87644571 CTGGAACACCACCACTTCAGAGG + Intergenic
1131202814 15:90414639-90414661 AGAGAACACCAACACTTAAGAGG - Intronic
1134430105 16:14195951-14195973 ATTGATCACCAACAATGCAGAGG - Intronic
1134685920 16:16158171-16158193 TTGGAAAACCAAGACTCAAGGGG - Intronic
1134913963 16:18053590-18053612 ATAGAAAACCAACCCTGCAGGGG - Intergenic
1136266726 16:29125582-29125604 ATGAAACACCTACAATGAAGAGG - Intergenic
1137713894 16:50585931-50585953 AAGGAACACCAACAGTGGACAGG - Intronic
1137938458 16:52658057-52658079 ATGGAACCCCAGCACTGGAGAGG - Intergenic
1138780946 16:59785101-59785123 ATGAAACAACCTCACTGAAGTGG - Intergenic
1139098960 16:63742953-63742975 ATGGAACAACCTCACTGAAAAGG + Intergenic
1141890212 16:86921254-86921276 ATGGAACACAAAGAGTGATGGGG - Intergenic
1142055578 16:87993560-87993582 ATGAAACACCTACAATGAAGAGG - Intronic
1143790513 17:9291515-9291537 TTGGAAAACCAACACAGAAAGGG - Intronic
1145236247 17:21210262-21210284 AAGGCACATCAATACTGAAGAGG + Intronic
1147878211 17:43636739-43636761 ATCAAACACCAACGCTGAAGAGG + Intergenic
1148062829 17:44848476-44848498 CTGGAGCACCAACACCAAAGTGG + Intronic
1149503759 17:57175633-57175655 CTGGAACCCCAACACTGAATTGG + Intergenic
1150674707 17:67234904-67234926 AGGGAACACTTCCACTGAAGAGG - Intronic
1151776583 17:76207867-76207889 ATGGAATACGAACTCTGAAGAGG + Intronic
1153343773 18:4004475-4004497 ATGGAACACTAACCTTGAATGGG - Intronic
1154435242 18:14337272-14337294 AGGGAACATCAACCCTGCAGTGG + Intergenic
1157098132 18:44705844-44705866 AGGGAACATCACCACTTAAGTGG + Intronic
1157849886 18:51038471-51038493 ATTCAACACCAAAACTCAAGTGG - Intronic
1158583969 18:58713008-58713030 ATGGTACAGCCTCACTGAAGAGG + Intronic
1162239998 19:9343675-9343697 AGGAAACATCCACACTGAAGAGG + Exonic
1164855206 19:31515864-31515886 ATGGAAAACCAATACAGAACGGG - Intergenic
1167812266 19:51844336-51844358 CTGGCACACAAAAACTGAAGAGG + Intergenic
928399554 2:30968006-30968028 ATGGAACACCTTCACAGCAGAGG - Intronic
929417337 2:41756796-41756818 ATGAAACAACCTCACTGAAGAGG + Intergenic
931905386 2:66837110-66837132 ATGTAACAGCAAAAATGAAGTGG + Intergenic
933409132 2:81903109-81903131 ATGCAACAACTTCACTGAAGGGG + Intergenic
936895470 2:117422738-117422760 ATGGATCAAAAACACTTAAGGGG + Intergenic
939281550 2:140072109-140072131 ATAGACCACCATCACTGAAAAGG - Intergenic
939695307 2:145316137-145316159 AAAGAACACTAACACTGAATCGG - Intergenic
1171368411 20:24643598-24643620 ATGAAACAACCTCACTGAAGGGG - Intronic
1172648881 20:36489211-36489233 TTGCAAAACCAACACTTAAGGGG - Intronic
1176338670 21:5622534-5622556 CTGTAACAACAAAACTGAAGGGG + Intergenic
1176340078 21:5685607-5685629 CTGTAACAACAAAACTGAAGGGG + Intergenic
1176472332 21:7117760-7117782 CTGTAACAACAAAACTGAAGGGG + Intergenic
1176495893 21:7499538-7499560 CTGTAACAACAAAACTGAAGGGG + Intergenic
1176504749 21:7638849-7638871 CTGTAACAACAAAACTGAAGGGG - Intergenic
1177610117 21:23435390-23435412 ATGGAACCCCAACAATGAAGTGG - Intergenic
1179906429 21:44425509-44425531 GTCGAACACCAGCTCTGAAGTGG - Intronic
1182536276 22:31005620-31005642 ATGCAACAACTTCACTGAAGAGG + Intergenic
1185246351 22:49775271-49775293 AGGGACCCCCAACACTGGAGCGG + Intronic
1203239346 22_KI270733v1_random:64-86 CTGTAACAACAAAACTGAAGGGG + Intergenic
949238947 3:1846592-1846614 ATGGAATAACCTCACTGAAGAGG + Intergenic
952167446 3:30766190-30766212 ATGGGGCACCAAGAATGAAGAGG + Intronic
953056443 3:39391297-39391319 AAGGAACACCAATAGGGAAGTGG - Intronic
953750827 3:45607233-45607255 ATGGAAAACAAAAACTGGAGTGG - Intronic
959173200 3:102869479-102869501 AAAGAAAACCAAAACTGAAGAGG - Intergenic
959607151 3:108253847-108253869 ATGGAACAATCTCACTGAAGAGG - Intergenic
960036041 3:113104264-113104286 ATGAAAGACCAGCACAGAAGAGG + Intergenic
963227627 3:142878259-142878281 ATGGAACACCCACAGAGAAGTGG - Intronic
964075517 3:152687237-152687259 ATGAGACATAAACACTGAAGGGG - Intergenic
964323406 3:155521433-155521455 CTGGAACACCAACTCTCATGAGG - Intronic
967668321 3:192201316-192201338 ATGGAACACAACAACTGAAATGG + Intronic
968795276 4:2699562-2699584 ATGGAACATAAACTCTGAAGAGG - Intronic
969549330 4:7853936-7853958 AAGGAACAGCCCCACTGAAGGGG + Intronic
970898193 4:21127558-21127580 ATAGAATACAAACACTGTAGTGG + Intronic
972855659 4:43103479-43103501 ATCCAAGAACAACACTGAAGGGG - Intergenic
973654046 4:53027352-53027374 TTGGAAAACCAACACTGAGCAGG - Intronic
977568227 4:98603665-98603687 GTGGAACACACACACTCAAGTGG + Intronic
978292654 4:107163290-107163312 ATAAAACAACTACACTGAAGTGG + Intronic
986656991 5:10023229-10023251 AAGACACACAAACACTGAAGGGG + Intergenic
987029191 5:13960299-13960321 AGTGAACCCCAACACTGGAGGGG + Intergenic
987705860 5:21461529-21461551 ATGAAACAACAACACTAATGTGG - Intergenic
989057754 5:37381345-37381367 ATGAAACAACAACACTGATGTGG - Intronic
989287563 5:39720417-39720439 AAGCAAAACCAACACTGAAGTGG - Intergenic
989352709 5:40504950-40504972 ATAGAACATCAACACTTAAAGGG + Intergenic
989523405 5:42425877-42425899 ATGGAAAGCCAACACTTAATGGG + Intronic
990173966 5:53086480-53086502 ATGGAAAACCAACATTTAAAAGG - Intronic
993125593 5:83831744-83831766 TTGGAACAGGAACACTGAAGTGG + Intergenic
993466698 5:88256051-88256073 ATGGAAGACCAACAACAAAGAGG + Intronic
993721858 5:91329262-91329284 ATGAAATTCCAACACTGAAGAGG - Intergenic
994321806 5:98403507-98403529 ATGGAATACCTACAATGAATAGG + Intergenic
998970713 5:147589056-147589078 TTGGGTCACCAACACTGTAGAGG + Exonic
999530096 5:152453440-152453462 ATGAAACATCTTCACTGAAGAGG - Intergenic
1000017085 5:157287602-157287624 ATGGAAGCCCAACAGAGAAGGGG - Intronic
1000680464 5:164177499-164177521 ATGGAAAACCAAAAATTAAGGGG + Intergenic
1000862041 5:166467807-166467829 GTGGAAGACCAGCACAGAAGTGG + Intergenic
1003519455 6:6845876-6845898 ATGGAACAACCTCACTGAAGAGG - Intergenic
1005025181 6:21455778-21455800 AGGAAACACCAACAGAGAAGAGG - Intergenic
1006270127 6:32958030-32958052 AGGGAACACCAATACTTAAAGGG - Intronic
1006412556 6:33882979-33883001 ATGGCACAGCTACCCTGAAGAGG + Intergenic
1007071556 6:39041832-39041854 ATGGAACCTCAAGACAGAAGGGG - Intergenic
1007733153 6:43964169-43964191 ATGAAAGACCAACCCGGAAGAGG - Intergenic
1010425452 6:75724235-75724257 ATGGAATATCAACACTCCAGAGG + Intergenic
1010567316 6:77431794-77431816 CTGGAACTCCAAGAATGAAGTGG + Intergenic
1011456214 6:87552652-87552674 ATGGGAAACCAAAACTTAAGAGG + Intronic
1013180929 6:107716485-107716507 ATTGAACACCTACACTCAAGGGG - Intronic
1014092244 6:117416987-117417009 ATGGAACACAAACACCAAAGGGG - Intronic
1014949110 6:127534439-127534461 ATGAAACACCAGAACTAAAGTGG - Intronic
1015004849 6:128266845-128266867 AGTGAAGACCAAAACTGAAGTGG + Intronic
1015141415 6:129938003-129938025 ATGCAAAACCCACACTTAAGAGG + Intergenic
1016641930 6:146359430-146359452 ATGCTACACCCACACTGGAGAGG - Intronic
1016805681 6:148210059-148210081 ATGAAACATCAGCACTGAAAAGG + Intergenic
1017023566 6:150161780-150161802 ATGCAACAACCTCACTGAAGGGG - Intronic
1017228517 6:152047370-152047392 TTGGAACTCCAACACTGTATTGG + Intronic
1017679115 6:156846077-156846099 ATGGACCAGGAACACTGCAGAGG - Intronic
1017680848 6:156862414-156862436 TTGGCACCCCAACACTTAAGGGG + Intronic
1018374036 6:163194631-163194653 GTGGCATACCTACACTGAAGAGG + Intronic
1019280551 7:197755-197777 TTCCAACACCAACACTGAAGAGG + Intronic
1024133025 7:46375837-46375859 ATGCAAAACCGACAGTGAAGTGG + Intergenic
1024722949 7:52158499-52158521 AAGGGACACAAGCACTGAAGGGG - Intergenic
1026184911 7:68075050-68075072 ATGGAACACCACGACTGACTGGG + Intergenic
1027359388 7:77392574-77392596 CTGGGAGACCATCACTGAAGGGG + Intronic
1027557436 7:79683413-79683435 ATGAAACAACGTCACTGAAGGGG - Intergenic
1028637074 7:93001154-93001176 ATAGAACACCAACACTGACATGG - Intergenic
1030458777 7:109805691-109805713 ATGGAATACTAACACTTAAAGGG - Intergenic
1032545128 7:132735807-132735829 ATGAAACACCAACCATGAAAAGG + Intergenic
1032982766 7:137303855-137303877 TTGCAAGACCAGCACTGAAGAGG - Intronic
1038245229 8:25848886-25848908 AGGAAACATCAACACTGAAGAGG + Intronic
1038799454 8:30736145-30736167 ATGAAAGATAAACACTGAAGAGG + Intronic
1040444676 8:47481616-47481638 ATTGAACACAAACACTGAAGTGG - Intronic
1042437623 8:68785590-68785612 ATGAAACAACCTCACTGAAGGGG - Intronic
1044363127 8:91311221-91311243 ATGCAACAACCTCACTGAAGTGG - Intronic
1048019007 8:130521144-130521166 ATGGAAGACCAAAAGTGAAATGG + Intergenic
1051637223 9:19191524-19191546 ATGTACCACCATCACTGTAGGGG - Intergenic
1053394192 9:37757679-37757701 CTGTAAGAACAACACTGAAGGGG + Intronic
1053551682 9:39086597-39086619 ATGGAAGAGCAGCACTGAATGGG + Intronic
1053815812 9:41906731-41906753 ATGGAAGAGCAGCACTGAATGGG + Intronic
1054614785 9:67280710-67280732 ATGGAAGAGCAGCACTGAATGGG - Intergenic
1056990406 9:91405406-91405428 ATGGAAGACCTACGCTGATGGGG + Intergenic
1059982548 9:119788965-119788987 ATGGAACACCTAAGCTGAAAAGG - Intergenic
1060075334 9:120585662-120585684 ATGGAACATCACAGCTGAAGGGG - Intergenic
1061554001 9:131355124-131355146 ATTGAACACCAAAACTTAAGAGG - Intergenic
1061700445 9:132411133-132411155 ATGGGAAACCAACACTGCTGTGG + Intronic
1062682957 9:137792985-137793007 ATGAAACCCCAACCCAGAAGCGG - Intronic
1203422989 Un_GL000195v1:12386-12408 CTGTAACAACAAAACTGAAGGGG - Intergenic
1186456480 X:9713838-9713860 ATGGAACACCACCCTTTAAGGGG + Intronic
1186728607 X:12383876-12383898 ATGGAATATTAGCACTGAAGGGG + Intronic
1186806513 X:13145526-13145548 ATGTATCACCAACCCTGGAGTGG - Intergenic
1186876383 X:13822138-13822160 ATGAAACACCAAAATTGCAGAGG - Intronic
1188325909 X:28800521-28800543 GTGGAACACTAGCCCTGAAGAGG + Intronic
1196802565 X:119556875-119556897 ATGGAATACCAATACTTGAGGGG + Intronic
1199117468 X:144009109-144009131 ATGGAACACTTATACTGAAAAGG - Intergenic