ID: 921112663

View in Genome Browser
Species Human (GRCh38)
Location 1:212054290-212054312
Sequence AAGAACAAGGAAAAGGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1648
Summary {0: 1, 1: 0, 2: 5, 3: 159, 4: 1483}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921112663_921112667 -7 Left 921112663 1:212054290-212054312 CCAGTCTCCTTTTCCTTGTTCTT 0: 1
1: 0
2: 5
3: 159
4: 1483
Right 921112667 1:212054306-212054328 TGTTCTTCTGGCTTGAAAGATGG 0: 1
1: 0
2: 2
3: 33
4: 261
921112663_921112668 25 Left 921112663 1:212054290-212054312 CCAGTCTCCTTTTCCTTGTTCTT 0: 1
1: 0
2: 5
3: 159
4: 1483
Right 921112668 1:212054338-212054360 TAATTTGCATTTTAGCTGCCTGG 0: 1
1: 0
2: 2
3: 11
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921112663 Original CRISPR AAGAACAAGGAAAAGGAGAC TGG (reversed) Intronic
901174296 1:7287466-7287488 GAGAAGAAGGAAAGGGAGAAAGG - Intronic
901382219 1:8882044-8882066 AAGAAAAAAGAAATGGAGGCCGG + Intergenic
901586117 1:10294503-10294525 AAGCACAAGGAAAAAATGACAGG - Intronic
901761006 1:11471617-11471639 AAGGAGAAGGAAGAGGAGAAGGG + Intergenic
901770204 1:11526309-11526331 AAGAATAAGGAAGACAAGACAGG - Intronic
903075903 1:20765994-20766016 CAAAACAAGAAAAAGGAGCCAGG + Intronic
903361420 1:22779580-22779602 AATGACAAGGACCAGGAGACTGG - Intronic
903536275 1:24068384-24068406 CAGAACAGGGAAAAGGACTCTGG - Intronic
903832657 1:26184035-26184057 AGGAACAAAGCAATGGAGACAGG - Intronic
903834635 1:26195480-26195502 AAGAAAAAGAAAAAAGAGCCTGG - Intronic
904030566 1:27531104-27531126 AAGAAAAAGAAAAAGGAAAGGGG + Intergenic
904172779 1:28603166-28603188 AAGTACAGGGAAAAGGGGAAGGG + Exonic
904311206 1:29630735-29630757 AAGAAGAAGGAAGAGAAGAAGGG - Intergenic
904355660 1:29937445-29937467 AAGAGCTAGGAGAAGGAGACTGG + Intergenic
904953170 1:34260791-34260813 AAGAAAAAGGAGAAGGAGAAAGG + Intergenic
905046577 1:35008191-35008213 ATAAATAAGGAAAAGGAGAGAGG - Intronic
905063581 1:35160555-35160577 AAGAAAAAGGAAAAAGACAGAGG - Intergenic
905355543 1:37381234-37381256 AAAAAAAAGGAAAAAGAAACAGG - Intergenic
905394756 1:37660066-37660088 ATGAATACGGAAAAGGAGCCTGG + Intergenic
905535430 1:38717876-38717898 AAGAACAAGGTGAAGGAAATGGG - Intergenic
905545499 1:38795648-38795670 AAGAACAAGGAAAAAAAGAAAGG + Intergenic
905814897 1:40941981-40942003 TATAACAAGGAAAACGAGAATGG - Intergenic
906176283 1:43775986-43776008 AAGAAAAAGGAATAGAAGGCAGG - Intronic
906511518 1:46412814-46412836 AAGGAAAAGGAAAAGAAAACAGG + Intronic
906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG + Exonic
906708060 1:47909447-47909469 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
906776683 1:48536114-48536136 GAGAACATGGACAAGGAAACAGG + Intronic
906803089 1:48754577-48754599 GAGAAAAAGGAAAAGGGGACTGG + Intronic
907090972 1:51725119-51725141 AAGCAAAAGGAAAAAAAGACTGG - Intronic
907449320 1:54533193-54533215 AAGAAGAAGAAAAAAGAAACAGG + Intergenic
908022778 1:59915542-59915564 GAGAATAAGGAAATAGAGACAGG + Intronic
908222312 1:62019694-62019716 AAGAAAACCAAAAAGGAGACTGG - Intronic
908239811 1:62179256-62179278 ACGACCATGGAACAGGAGACTGG - Intergenic
908258930 1:62324455-62324477 AAAAAAAAAGAAAAGGAGAAAGG + Intergenic
908779410 1:67675754-67675776 AAGAACAAAGAAAATTAGAAAGG + Intergenic
909091911 1:71236586-71236608 AAGAGAAAGGAAAGGGAGACAGG - Intergenic
909448898 1:75776992-75777014 AAAAAAAAGGGAAAGGAAACAGG - Intronic
909684483 1:78331857-78331879 AAGAAGAAAGAGAAGGAGAGAGG - Intronic
909727412 1:78851989-78852011 AAGAACAAGGCAAAGGAACAGGG + Intergenic
909913224 1:81285913-81285935 AAAAAGAAGGAAAAGAAGCCTGG - Intergenic
909923960 1:81416148-81416170 AGCAATAAGGAAAAGGAGACCGG - Intronic
909934666 1:81537669-81537691 AAAAAAAAGAAAAAGAAGACAGG - Intronic
909966815 1:81922889-81922911 AAGAAGGAGGAAAAGAAGAAAGG - Intronic
910038723 1:82821345-82821367 AAGAAAAAAGGAAAGGAGAAGGG - Intergenic
910198289 1:84668807-84668829 AAAAATAAGGAAAAGTAAACGGG + Intronic
910330661 1:86069085-86069107 AAGCAAAGGGAAAAAGAGACGGG + Intronic
910433842 1:87185159-87185181 AAGAACAATGAGAAGCAGAAGGG - Intergenic
910460912 1:87447213-87447235 AAAAAAAAAAAAAAGGAGACTGG - Intergenic
910505793 1:87948994-87949016 AAGCAAAAGGAAGAGGAGGCAGG + Intergenic
910532210 1:88250442-88250464 AGGAACAAGGAAAGGAAGAAGGG + Intergenic
910766512 1:90787961-90787983 ATGAACAAGCAGAGGGAGACAGG - Intergenic
910798724 1:91123901-91123923 AGGAAGAAGGAAAAAGAGCCTGG + Intergenic
911642853 1:100307319-100307341 AAAAACAAAAATAAGGAGACAGG - Intergenic
911663838 1:100532637-100532659 GAGAGCAGGGAAAATGAGACTGG - Intergenic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
911991741 1:104706897-104706919 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
912142251 1:106744930-106744952 AAAATCAAGGAGAAGTAGACTGG + Intergenic
912191573 1:107347017-107347039 AAGAACAAGGCAAAGCAAGCAGG + Intronic
912215891 1:107611616-107611638 ACAAACAAAAAAAAGGAGACAGG + Intronic
912222398 1:107693233-107693255 AAGTTCAGGGAAAAGGAGAGTGG + Intronic
912393728 1:109323198-109323220 AAGAACAAGGAGAGGGAAAGTGG + Intronic
912608428 1:111017424-111017446 AAGAACAACAAAAAGGAGCATGG - Intergenic
912630468 1:111242409-111242431 CAGAACAGGGCACAGGAGACTGG + Intronic
912687253 1:111777293-111777315 AAGAAGTAGGAAAAGGAGGTAGG + Intronic
912709203 1:111937718-111937740 ATGGCCAAGGAAAAGGGGACAGG + Intronic
912753517 1:112305060-112305082 AAGAAAGAGGAAAATGAAACAGG + Intergenic
912791613 1:112657485-112657507 ATGGACAAGGAAAAGGACACTGG - Intronic
912919320 1:113850283-113850305 AAGAAAAAGAAAAATCAGACAGG + Intronic
913685078 1:121223857-121223879 AACTACAAAGAAAAGCAGACAGG - Intronic
913963596 1:143357042-143357064 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
913969624 1:143404907-143404929 AAAAAGAAGGAAAAGAAGAACGG - Intergenic
914036923 1:144011461-144011483 AACTACAAAGAAAAGCAGACAGG - Intergenic
914057956 1:144182631-144182653 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914063999 1:144230500-144230522 AAAAAGAAGGAAAAGAAGAACGG - Intergenic
914115151 1:144735854-144735876 AAAAAGAAGGAAAAGAAGAACGG + Intergenic
914121190 1:144783734-144783756 AAAAATAAGGAAAGGGAGGCTGG + Intergenic
914152531 1:145056470-145056492 AACTACAAAGAAAAGCAGACAGG + Intronic
914261838 1:146005457-146005479 TAGAATAAGAAACAGGAGACAGG - Intergenic
914784065 1:150812318-150812340 GAGAACTAGGAAAAGGAAAAAGG - Intronic
914820857 1:151101589-151101611 AAGAAAAAAGAAAAGAATACAGG + Intronic
914840128 1:151241504-151241526 AAGAAAAAGAAAAAGGGGGCAGG + Intronic
915046045 1:153018114-153018136 GAGAGCAAGGAAAAGCAGGCTGG + Intergenic
915825740 1:159074054-159074076 AACAACAACAAAAAGGAAACAGG + Intronic
915859165 1:159423677-159423699 TCAAAGAAGGAAAAGGAGACTGG - Intergenic
916067083 1:161144800-161144822 AAGAAAAAGAAAAAAAAGACGGG + Intergenic
916188586 1:162157153-162157175 ATGATGAGGGAAAAGGAGACTGG - Intronic
916472715 1:165139524-165139546 AAGAAAAAGAAAAAAGAAACAGG + Intergenic
916472731 1:165139776-165139798 AAGAAAAAAGAAAAGGAGGTGGG + Intergenic
916584268 1:166136615-166136637 ATGAACAAGTAAATGGAAACAGG + Intronic
916636429 1:166674246-166674268 AAGAACAAGAAGAGGAAGACAGG - Intergenic
916693326 1:167212007-167212029 AAGAAGAGGGAAAGTGAGACTGG + Intergenic
916745995 1:167685334-167685356 AAGAGCAAGGAAATGGAAACTGG - Intronic
917148024 1:171913705-171913727 AGAAACAAGGAAAGGGAAACAGG - Intronic
917269561 1:173258326-173258348 AAGAGCAAGGAAAAGCAGGGTGG + Intergenic
917439195 1:175051788-175051810 AAAAAAAAAGAAAAGGAGAGTGG + Intergenic
917670852 1:177272098-177272120 TACTACAAGGAAAAGGAGAAGGG - Intronic
917855541 1:179096336-179096358 AAGAACCAAGAAAAGGGGAAAGG - Intronic
917871702 1:179248055-179248077 AAGAAAAAGGAAAGAGAGAGAGG + Intergenic
918638825 1:186813446-186813468 AAAAACAATAACAAGGAGACAGG - Intergenic
918662462 1:187106426-187106448 AAGAGGAAGGAAAAGTGGACTGG - Intergenic
918743704 1:188170765-188170787 AAGAACAAGAAAAATGTGGCAGG - Intergenic
919016764 1:192048504-192048526 AAAAAGAAGGAGAAGGAGAAGGG + Intergenic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
919018257 1:192069030-192069052 AAGAACTAGAAAAAGCAGGCTGG + Intergenic
919236713 1:194855154-194855176 AAGAAAAAGGAAAAAGGGCCCGG + Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
920112337 1:203595972-203595994 AAAAAAAAAAAAAAGGAGACTGG - Intergenic
920222064 1:204411401-204411423 AAGAAAAAGGAGATGGAGCCGGG - Exonic
920254818 1:204647516-204647538 GACAACAAGGAAAGGGAGAGAGG + Intronic
920364308 1:205440077-205440099 AAGAAAAAGGCAGGGGAGACAGG + Intronic
920472395 1:206242414-206242436 AACTACAAAGAAAAGCAGACAGG - Intronic
920540341 1:206773470-206773492 AATAACAAGGAAAAGAAGTCAGG + Intergenic
920549322 1:206845446-206845468 AAGAGAAAGGAAAAGTAGACGGG - Intergenic
920748522 1:208651836-208651858 AAAAAAAAGAAAAAAGAGACTGG - Intergenic
920928845 1:210368004-210368026 AAGAAGAAAGAAAAAGGGACTGG - Intronic
921034219 1:211360974-211360996 AAGGACCAGGAGAAGGAGAGAGG - Intronic
921080520 1:211735518-211735540 CAGAACAAAGAAAAGGGGAGGGG - Intergenic
921112663 1:212054290-212054312 AAGAACAAGGAAAAGGAGACTGG - Intronic
921279860 1:213555853-213555875 AAGATGAAGGAAAAGGAGCCAGG - Intergenic
921326347 1:213989010-213989032 AAGAGAAAGGACAAGGGGACCGG - Intronic
921495504 1:215835883-215835905 AAGAACAAGGAAAGTGAGAGAGG - Intronic
921945641 1:220884258-220884280 AAGGACAAGGACAAGGAGGCTGG + Exonic
922212096 1:223494254-223494276 AAGGTCCAGGAGAAGGAGACAGG - Intergenic
922323620 1:224509340-224509362 AAGAAGAAGGGAAAGAAGAAAGG + Intronic
922338135 1:224634285-224634307 AAGAATAAGAAAAAAGAGGCCGG + Intronic
922555096 1:226526989-226527011 AACAAACAGGAAAAGGTGACTGG + Intergenic
923030582 1:230246361-230246383 AAGGTCAAGGAAGAGGAGAAAGG - Intronic
923072434 1:230577883-230577905 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
923378672 1:233392642-233392664 AAGGAAAAGGAAAAGGGGAAGGG - Intergenic
923378675 1:233392648-233392670 AAGGAGAAGGAAAAGGAAAAGGG - Intergenic
923846756 1:237742262-237742284 AAAAAAAAAAAAAAGGAGACAGG - Intronic
924207460 1:241728000-241728022 AAGATCTAGGAAAAGGAAAAGGG + Intronic
924227077 1:241930877-241930899 AAGAAAAAAGAAAAGGAAAAAGG + Intergenic
924274725 1:242374270-242374292 CAGAACCAGGAAAAGGAAAACGG + Intronic
924375377 1:243402416-243402438 AAAAAAAAGCAAAAGGAAACAGG + Intronic
924493041 1:244558762-244558784 AAGGAGAAGGAGAAGGAGAGGGG - Intronic
924586238 1:245363490-245363512 AAGAAAAGAGAAAAGGAGGCCGG - Intronic
924659100 1:246000341-246000363 AGGAGAAAGGAAAAGGAGACAGG + Intronic
924732926 1:246728644-246728666 AAGAACAAGGAAAGAGAGACGGG - Intronic
924735009 1:246747911-246747933 AAGAACAAAGAACAGGGGAGCGG + Intronic
1063446113 10:6118462-6118484 AAGAAAAAAAAAAAGGAGGCCGG - Intergenic
1064048181 10:12037937-12037959 AAGAAAAAGGAGAAGGAAAAAGG - Intronic
1064344625 10:14520888-14520910 AGGAAAAAGGAAGAGGACACTGG - Exonic
1065038130 10:21661605-21661627 AATAAAAAGGAAATGGAGAAAGG - Intronic
1065101087 10:22334340-22334362 GAAAATAAGGAAAAGGAGAGAGG - Intergenic
1065227983 10:23566301-23566323 AAAAAAAAGGAAAAGAAGATAGG - Intergenic
1065414125 10:25466076-25466098 CAGAAAAAGGAAAAGGGGAGGGG + Intronic
1065670485 10:28111126-28111148 AAGCACAAAGAAAATGAGAAAGG + Intronic
1065835369 10:29652986-29653008 AAAAAAAAGGAAAAGGAAAAAGG - Intronic
1065859887 10:29863672-29863694 TAGAACAAAGAAAAGATGACTGG + Intergenic
1065966987 10:30778727-30778749 AAGAAGAAGGATAAGGAGGGGGG + Intergenic
1066114548 10:32227931-32227953 AAGAAGATGGAAAAGCAGACTGG - Intergenic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1066434947 10:35388946-35388968 AAGAAGAAGGCAGAAGAGACAGG - Intronic
1066792475 10:39081033-39081055 ATGACCATGGAACAGGAGACTGG - Intergenic
1067150654 10:43730039-43730061 AAGAAGAAGAAGAAGAAGACAGG + Intergenic
1067185471 10:44023649-44023671 AAAAACAACAAAAAGGAAACTGG + Intergenic
1067202497 10:44185464-44185486 AAAAAGAAGTGAAAGGAGACAGG + Intergenic
1067274396 10:44821316-44821338 AAGCAGAAGGAAAAGAAAACTGG - Intergenic
1067460298 10:46453235-46453257 AAGAATATGGGGAAGGAGACAGG - Intergenic
1067626892 10:47931368-47931390 AAGAATATGGGGAAGGAGACAGG + Intergenic
1067723652 10:48749928-48749950 AAGTTCAAGGTAAAGGTGACTGG - Intronic
1067979249 10:51064894-51064916 AAGAACAAGGGAGGGGAGATGGG + Intronic
1068008939 10:51423446-51423468 AGAAATAGGGAAAAGGAGACAGG - Intronic
1068124823 10:52826730-52826752 AAGTAAGAGGAAAAGGAGAAGGG - Intergenic
1068231906 10:54178612-54178634 AAGAACAATGAAAAGAAGTGGGG + Intronic
1068513791 10:58000674-58000696 AAGAAAGAGGAAAAGGAGGCAGG + Intergenic
1068521043 10:58077791-58077813 AAGAAAAAGAAGAAGAAGACAGG + Intergenic
1068764815 10:60751513-60751535 AAGAACAGGGATAAGGTGACTGG - Intergenic
1068775327 10:60862639-60862661 AAGAAAAAAGAAAGGGAGAAAGG - Intergenic
1068814318 10:61292462-61292484 AGGAAGAGGGAAAAAGAGACAGG - Intergenic
1068855860 10:61796619-61796641 ATGAACAGGGAAAGGGAGAAAGG - Intergenic
1068887259 10:62110425-62110447 AGGAACAAGGAAGACGAGAAGGG - Intergenic
1068927451 10:62554984-62555006 AAAAACAAGGAAATGAAGAAGGG - Intronic
1069033951 10:63629209-63629231 AAGAAAAAGGAAAACGAAAAGGG + Intergenic
1069187995 10:65450993-65451015 AATAACAATGATAATGAGACTGG - Intergenic
1069360084 10:67632530-67632552 AAGAACAAAGAAAAGCAGGGTGG + Intronic
1069404296 10:68081876-68081898 AAGAACAACGAAAAGGTGAATGG - Intergenic
1069737298 10:70665251-70665273 AAGAAAAAGAAAAAGAAAACTGG - Intergenic
1069972896 10:72188514-72188536 AAAGAAAAGGAAAAGGAGAAAGG + Intronic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070362985 10:75708621-75708643 AACAACAAGGCACAGGAGATAGG + Intronic
1070392465 10:75983255-75983277 AGGAACAAGGAAAGGGCTACAGG + Intronic
1070424310 10:76270607-76270629 AAGCAGAAGGAAAAGAAGACAGG - Intronic
1070457487 10:76631793-76631815 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1070953804 10:80451752-80451774 AAGAAGACTGAAAAAGAGACTGG - Intergenic
1071163086 10:82774794-82774816 AAGAAAAAGGAAAATAAAACTGG - Intronic
1071434042 10:85630214-85630236 AAGAACAAGGGTTTGGAGACAGG + Intronic
1071591209 10:86875023-86875045 AAAAAAAAGAAAAAGGAGCCAGG - Intronic
1071763894 10:88639982-88640004 AAGGAAAAGGAAGAGAAGACAGG + Intergenic
1071952273 10:90717372-90717394 ATGAAGAAGGAAAAGGAGCATGG + Intergenic
1071991685 10:91105754-91105776 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1072047364 10:91670573-91670595 AAGAATAAAGAAAAGGATTCAGG + Intergenic
1072136628 10:92553125-92553147 AAGAAAAAGAAAAAGCAGGCTGG + Intronic
1072421990 10:95297010-95297032 AGGAACAGGGCAAAGGAGGCAGG + Intergenic
1072473346 10:95734552-95734574 AAGAACAATTAAACGGAGAAGGG + Intronic
1072492275 10:95919883-95919905 AAGAAAAGGGAAAAGCAGAGAGG - Intronic
1072549869 10:96469364-96469386 AAGAACAAGGCAAGAGCGACTGG - Intronic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1072875891 10:99172884-99172906 AAGAAGAAGAAAAAGAAGAAAGG + Intronic
1073366385 10:102945654-102945676 AACAACAAGGGAAGGGAGAATGG - Intronic
1074171542 10:110944013-110944035 ACGAGCAAGAAAGAGGAGACTGG - Intronic
1074503709 10:114047970-114047992 AAAAAAAAGGAAAAGGAAAAAGG + Intergenic
1075295706 10:121273128-121273150 AAGAAGAAGGAAAAGGCCTCTGG + Intergenic
1075344913 10:121674874-121674896 AAGAAGAACGGGAAGGAGACTGG - Intergenic
1075378721 10:122000593-122000615 ATTAAGAAAGAAAAGGAGACAGG - Intronic
1075547507 10:123366263-123366285 AATAAAAGGGAAAAGGAGATGGG + Intergenic
1075611353 10:123857276-123857298 AAAATGATGGAAAAGGAGACAGG + Intronic
1075882553 10:125866266-125866288 AAAAAAAAGGAAAAAGAAACTGG - Intronic
1076283997 10:129275719-129275741 AAGTCCATGGAAAAGGATACAGG - Intergenic
1076304856 10:129458806-129458828 AAGGACAAAGAGAGGGAGACAGG - Intergenic
1076424555 10:130358396-130358418 AAAAACAAGGAAAATGCGAGTGG - Intergenic
1076489709 10:130850072-130850094 AAGATGAAGGAGAAGGAGAGGGG - Intergenic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1076582104 10:131518635-131518657 ACGGACAAGGAAACAGAGACTGG - Intergenic
1076870882 10:133193569-133193591 AAGAACAAGAAGAAGGAAAAAGG + Intronic
1077903176 11:6506739-6506761 AAGAACAGGCAAAGGGAGATTGG - Intronic
1078130697 11:8611879-8611901 AAGAAGAAGAAAAAGCAGAGAGG + Intergenic
1078173541 11:8950137-8950159 AAGAAAAAAAAAAAGGAGGCAGG + Intronic
1078225400 11:9387470-9387492 AAAAACAAGTGAAAGGAGATAGG - Intronic
1078245262 11:9568412-9568434 GAGAACAAGCATAAGGAGAAAGG + Intergenic
1078255626 11:9656101-9656123 AAGAAAAAGGAAAAGGTGGAGGG + Intergenic
1078536988 11:12183158-12183180 AAGAAAAAAAAAAAGGAGTCAGG - Intronic
1078612938 11:12837707-12837729 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1078899915 11:15632266-15632288 TAGAAGAAAGAAAAGAAGACTGG - Intergenic
1079030749 11:16984625-16984647 AATGAGCAGGAAAAGGAGACAGG - Intronic
1079158240 11:17968833-17968855 AAAAAGTAGGGAAAGGAGACAGG + Intronic
1079341674 11:19616773-19616795 AAGAACCAGGAAAAGGAAAAAGG - Intronic
1079432374 11:20405105-20405127 AAGAAGGAAGAAAAGGAGGCTGG - Intronic
1079711514 11:23688971-23688993 CATAACAAGGCAAAGGTGACGGG - Intergenic
1079724568 11:23865126-23865148 CAGAAGAAGGAAAAGGAGTAGGG - Intergenic
1079804515 11:24912228-24912250 AAAAAAAAAGAAAAGGAGACAGG - Intronic
1079991480 11:27251006-27251028 AAGAAAAAGGAAAAGAAAAAGGG + Intergenic
1080290546 11:30666053-30666075 TAGAACAAGAAGAAGGAGAAGGG + Intergenic
1080349982 11:31372549-31372571 ATGAACCTGGAAAAGTAGACTGG + Intronic
1080385270 11:31807191-31807213 AAGAACCAGGAAAAGGGGAAGGG + Intronic
1080496233 11:32823108-32823130 AAGAAAAAGGAAAAGGAAAAAGG + Intergenic
1080740643 11:35061103-35061125 AAAAAAAAAAAAAAGGAGACAGG + Intergenic
1081117306 11:39219413-39219435 AAGAAAAAAGAAAAAGAGAGAGG + Intergenic
1081164887 11:39796083-39796105 CAGAACAGAGAAAAGGAAACTGG - Intergenic
1081197122 11:40175362-40175384 GTGAACAAGGAAAACCAGACCGG + Intronic
1081252922 11:40857916-40857938 AAAAAGAAAGAAAAGGAGAAAGG + Intronic
1081352293 11:42069006-42069028 AAGAAGAAGGAAAAGAAGTGAGG + Intergenic
1081354809 11:42099565-42099587 GAGAGCAAGGAGAAGGAGAGTGG + Intergenic
1081752743 11:45523695-45523717 AAAAACAAGAAAAATGAAACAGG + Intergenic
1081789995 11:45775681-45775703 AAGGACAGGGGAAAGGAGATGGG + Intergenic
1082043389 11:47705656-47705678 AAGAAAAAGAAAAAGAAGAAAGG + Intronic
1082080350 11:48007951-48007973 AAGAACCAGGAACTGGAGCCAGG - Intronic
1082123182 11:48402541-48402563 AAGAACAAGCACAAGGGGTCAGG + Intergenic
1082661300 11:55914574-55914596 AAGAACAAGGAAGAATGGACTGG - Exonic
1082921688 11:58502253-58502275 ATGAACATGAAAAAGGAGACTGG + Intergenic
1083400182 11:62418153-62418175 AAGAACCAGGAAATGGCAACTGG + Intronic
1083466501 11:62850362-62850384 AAAAACAAAGAAAAGCAGCCAGG + Intergenic
1083870143 11:65482292-65482314 AAGAAAAAGAAAAAGCAGCCTGG + Intergenic
1083909277 11:65696575-65696597 AAAAAAAAAAAAAAGGAGACGGG + Intergenic
1084370200 11:68736744-68736766 CAGAAGGAGGAAAAGGAGAGAGG + Intronic
1084563935 11:69919130-69919152 AAGAACAAGGAAGTGGGGCCTGG - Intergenic
1084892310 11:72242641-72242663 AAGAAGAAGAAGAAGAAGACTGG - Intronic
1084898271 11:72291745-72291767 AAAAACAATGAAAAGCAGGCCGG + Intergenic
1085135572 11:74084445-74084467 AAGAAAAAGAAAAAAGAAACGGG + Intronic
1085651023 11:78268806-78268828 CTGAAGGAGGAAAAGGAGACAGG - Intronic
1085707535 11:78800201-78800223 AAGCACAAGGAAGGGGAGATGGG + Intronic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086196154 11:84142330-84142352 AAAAAAAAAGAAAAGGTGACTGG + Intronic
1086380344 11:86245528-86245550 AGGAACTAGGCAAAGGAGAGTGG + Intronic
1086554309 11:88091064-88091086 AAGAAAAAGGACCAGGAGAAGGG + Intergenic
1086965602 11:93024625-93024647 AAGAAGGAGGAAAAGCAGGCAGG + Intergenic
1087128674 11:94650749-94650771 AAAACCAAGGAAAAGGACTCAGG - Intergenic
1087265991 11:96061782-96061804 AAAAAAAAGGAAAAGAAGAAGGG - Intronic
1087419420 11:97901963-97901985 AAGACAAAGGAAGAGGAGAAAGG - Intergenic
1087811861 11:102616748-102616770 AAGAAAAGGGAAAAAGAGAGAGG + Intronic
1087930513 11:103972418-103972440 AATAAAAAGGAGAATGAGACAGG - Intronic
1087968106 11:104444023-104444045 AACAACCAGGAAAAGGATGCAGG - Intergenic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1088154552 11:106787505-106787527 AAGAAAAAGGAAAGAGAGAAAGG + Intronic
1088548074 11:110981722-110981744 AAGAACAAGGCAGAAGAGGCAGG + Intergenic
1088646760 11:111923785-111923807 AAAAACAAGGACAAGGAAGCAGG + Intronic
1088807440 11:113365360-113365382 AAGAAGGAGGATAAAGAGACAGG - Intronic
1088824654 11:113483565-113483587 AAGAAAGAAGAAAAGGAGAGAGG + Intergenic
1089596043 11:119580963-119580985 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1089629136 11:119773011-119773033 AAGAACAAGGTCAGGGAGGCTGG - Intergenic
1089733053 11:120531562-120531584 AAGAAAAAGAAAAAAGAAACAGG - Intronic
1089876393 11:121725780-121725802 AAGGACAAGAAAAAGAAGCCTGG - Intergenic
1089911290 11:122103128-122103150 AATAGCAAGGAAAGGGAGAAAGG + Intergenic
1089964380 11:122643781-122643803 AAGAAAAAGAAAAAAGAAACAGG + Intergenic
1090121991 11:124039628-124039650 AAGACAAAGGAACAGAAGACCGG - Intergenic
1090144664 11:124308695-124308717 AAGAAAAAGTAAAGGGAGAAAGG + Intergenic
1090297820 11:125605135-125605157 AAGAAAAAAAAAAAGCAGACTGG + Intronic
1090470613 11:126977932-126977954 GACACCAAGAAAAAGGAGACAGG - Intronic
1090840559 11:130484212-130484234 AAGAAAAACGAAAAGGAGGAAGG + Intergenic
1091129863 11:133136636-133136658 GAGAATAGGGAAAAGGAGAAAGG + Intronic
1091192464 11:133706963-133706985 AAGTGCAAGGGAAAGGAGAAGGG + Intergenic
1091329356 11:134718963-134718985 AACAACAAACAAATGGAGACAGG - Intergenic
1091439490 12:501586-501608 AAGAAAAAGGAAAAAGAAATAGG + Intronic
1091703449 12:2678847-2678869 CAGGACAAGGAAAAGAATACTGG + Intronic
1091916841 12:4275829-4275851 AAGAACAAAGATGAGGAAACTGG - Intronic
1092149532 12:6237653-6237675 AAGAAAAATGACAAGGAGAATGG - Intronic
1092195851 12:6549339-6549361 AAGAGCAAGGAAAAGGGAAAGGG + Intronic
1092283409 12:7114442-7114464 AAGAACAAGGATGAGGACAACGG + Intergenic
1092288187 12:7142091-7142113 AAGAACAAAGAGAAGGAAAAGGG + Exonic
1092406646 12:8226202-8226224 AAAAAGATGGAAAAGAAGACAGG - Intronic
1092473573 12:8799642-8799664 AAGAAAAGAGAATAGGAGACAGG + Intergenic
1092763593 12:11831585-11831607 AGAAAAAAGGAAAAGGAGACAGG + Intronic
1092964613 12:13629601-13629623 AAGAGGAAGGGAAAGGAGAAAGG - Intronic
1093040410 12:14372759-14372781 AACAACAAAGAAAGGGAGAACGG - Intronic
1093040994 12:14379228-14379250 AAGAACAAGAGAAAGGTGAGAGG - Intronic
1093364083 12:18271090-18271112 CATACCAAGGAATAGGAGACAGG + Intronic
1093643059 12:21550638-21550660 AAGACAAAGAAAAAGGAGACAGG + Intronic
1093761759 12:22918834-22918856 AAGAGGAAAGAAAAGGAGATCGG + Intergenic
1093858154 12:24130627-24130649 AAGAGAAGAGAAAAGGAGACAGG + Intergenic
1094246567 12:28303220-28303242 AGGAAGAAGAAAATGGAGACGGG + Intronic
1094291587 12:28856400-28856422 AAGAACAAAGAAAAAGAGAAGGG + Intergenic
1094459579 12:30680104-30680126 AAGAAGAAGGAAAAGAAGAAGGG - Intronic
1095465596 12:42484587-42484609 AACAGCAAAGAAAAGGAGCCAGG + Intronic
1095501185 12:42840082-42840104 AGGAACAAGGAAAAGACCACAGG - Intergenic
1095622239 12:44271297-44271319 GAGAAGAAGGAAAAGCAGAATGG - Intronic
1095694476 12:45129192-45129214 AAGAAAAAAGAAAAGGAGGCCGG + Intergenic
1095710969 12:45287623-45287645 GAGAATAAGGAAAAGGAGTCAGG + Intronic
1095897967 12:47299784-47299806 AAGAAGGAGGAAAAGGAGGGAGG + Intergenic
1095905532 12:47373719-47373741 AAGAAAAAAGAAAAAGAGAAAGG + Intergenic
1096101580 12:48973242-48973264 AAGAAAAAGGATAAGGACACTGG - Intergenic
1096276216 12:50210447-50210469 AAGAACAACCAAAAGGAAACGGG + Intronic
1096570633 12:52521139-52521161 AAGAGCAAGGAAAAGGTCAAAGG - Intergenic
1097285560 12:57874386-57874408 CGGAAAAAGGAAAAGGAGCCTGG - Intergenic
1097524135 12:60709298-60709320 AAAAACAAAGAAAAGAAGTCAGG - Intergenic
1097548038 12:61029303-61029325 AAGGAGAAGGAGAAGAAGACAGG - Intergenic
1097625745 12:61998145-61998167 CAGAGCAAGTAAAAGGAGAGTGG + Intronic
1098031001 12:66253793-66253815 TAGATCAAGGAAATGGAAACCGG - Exonic
1098152668 12:67563767-67563789 AAGAAAAATGGAAAGGAGAAAGG - Intergenic
1098289528 12:68944693-68944715 AAAAACAAGGTGAAGGAGCCAGG - Intronic
1098378142 12:69839294-69839316 AAGACCAAGGGAAAAGAGAGGGG - Intronic
1098395033 12:70008021-70008043 AAGAAGCAGGAAAAAGAGGCGGG - Intergenic
1098476768 12:70913704-70913726 GACAACAAGGAAATGGAGATGGG - Intronic
1098665511 12:73157689-73157711 AAGAAAAATGAAGAGGAGAAAGG - Intergenic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098783436 12:74718348-74718370 AAGAAGAAGAAGAAGAAGACAGG - Intergenic
1098946004 12:76590214-76590236 AAGAATAAGGCAAAGGTGATAGG + Intergenic
1098958292 12:76710580-76710602 AAGAGGCAGGAAAAGGAGAATGG + Intergenic
1099157900 12:79202521-79202543 AAGAAGAAAGAGAAGGAGTCAGG + Intronic
1099164467 12:79285888-79285910 AAGAAGAAGGGAAAGGAAAAAGG + Exonic
1099397355 12:82157541-82157563 AAATACAAAGAAAAGGAGCCAGG + Intergenic
1099403241 12:82225993-82226015 AAAAACAAAGAAAAGGAGAAAGG - Intronic
1099616430 12:84941516-84941538 AAGGAAAAGGAGAAGGAGAAGGG + Intergenic
1100082888 12:90874645-90874667 AAAAACATGAAAAGGGAGACTGG + Intergenic
1100153427 12:91769459-91769481 GAGAACAAAGAAAAGAAGAGAGG + Intergenic
1100455973 12:94752136-94752158 AAGAAAAAGGAAAGGAAGGCCGG - Intergenic
1100725882 12:97408079-97408101 AAGAAAAAGGAATAGTAGATAGG - Intergenic
1100747336 12:97660845-97660867 AAGAACAAGCAAAGGGGCACGGG + Intergenic
1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1100995799 12:100299505-100299527 AACTGCAAGGAAAAGGGGACAGG - Intronic
1101041213 12:100757704-100757726 AAGAACAAAGAACAGTAGGCAGG - Intronic
1101101399 12:101397489-101397511 AAGAAAAAAAAAAAAGAGACAGG - Intronic
1101106214 12:101443189-101443211 AACAGCAAGGAAAACTAGACAGG - Intergenic
1101226247 12:102690853-102690875 AAGAACAAGGTAAAGAAGTATGG - Intergenic
1101371036 12:104130845-104130867 AAGATCAAGGTGCAGGAGACAGG + Intronic
1101663000 12:106783531-106783553 AAGAGAATGGAAAAGTAGACTGG - Intronic
1102077152 12:110068721-110068743 AAGAGCCAGAATAAGGAGACAGG - Intronic
1102166750 12:110813006-110813028 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1102205943 12:111090971-111090993 AAGATCAAGGAGAAGCACACAGG - Intronic
1102382249 12:112477022-112477044 AAGAAAAAAGAAAAGGGGAGGGG - Intronic
1102409493 12:112704929-112704951 AAGAACCATAAAAATGAGACTGG + Intronic
1102437599 12:112937508-112937530 AATAAGCAGAAAAAGGAGACAGG + Intergenic
1102536761 12:113587697-113587719 AAGGAGAAGGAAAAGGAGTGGGG - Intergenic
1102544100 12:113642312-113642334 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1102723138 12:115034901-115034923 AAGAGCAAAGAAAGGGAGAATGG + Intergenic
1102889064 12:116544083-116544105 AAGGACTGGGAAAAGGAGATTGG - Intergenic
1103118939 12:118364289-118364311 AATGAAAACGAAAAGGAGACTGG + Intronic
1103233664 12:119353572-119353594 AAGAAGAAGAAGAAGGAGAGAGG - Intronic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103256038 12:119542334-119542356 AAGAAGAAGAAAAAGGACAAAGG + Intergenic
1103346391 12:120253486-120253508 AAGAAAAAGAAAAAAGAGACCGG + Intronic
1103371578 12:120423335-120423357 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1103465317 12:121137874-121137896 AAGAGCCAGGATAAGGAGACAGG + Intronic
1103825093 12:123731674-123731696 TAGAACCAGGAAAAAGAGGCTGG - Intronic
1103846927 12:123908257-123908279 AAGAACAGAGACAGGGAGACAGG - Intronic
1104091474 12:125521320-125521342 TGGAATAAGGAAAAGGAGAAGGG - Intronic
1104294797 12:127502230-127502252 AAGAGCCAGGACAGGGAGACAGG - Intergenic
1104703431 12:130924677-130924699 AAGAAGAAGAAGAAGAAGACTGG - Intergenic
1105000256 12:132686420-132686442 AAAAACAAGAAAAATTAGACAGG - Intronic
1105056034 12:133099971-133099993 AAGAAAAAGAACAAGGAGAGTGG - Intronic
1105572846 13:21620348-21620370 AAGAGAAAGGAGAAGGAGATTGG - Intergenic
1105697888 13:22908468-22908490 AGGAACAAGGTATTGGAGACTGG - Intergenic
1106118968 13:26842024-26842046 AAGAACGAGAAAATGGGGACTGG + Intergenic
1106306012 13:28510317-28510339 AAGAAAAAAGAAAAGCAGACAGG + Intergenic
1106332594 13:28753280-28753302 AAGAAAAAAGAAAAAGAGAAAGG + Intergenic
1106438933 13:29748334-29748356 ATGAACCAGGAAAAGGAGCACGG - Intergenic
1106513978 13:30436805-30436827 AAGAAAGAGGAAAAGGAGGCTGG - Intergenic
1106544209 13:30716259-30716281 AACAACAGGGAAAGGGACACCGG + Intronic
1106614261 13:31311939-31311961 AACATCAAGGAAAAGGGGATAGG + Intronic
1106661167 13:31800932-31800954 AAGGACAAGGAAGAGAAGATAGG + Intronic
1106771517 13:32965290-32965312 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1106872782 13:34039637-34039659 AAGAAGAAGGAAAAAGAGAAGGG - Intergenic
1106958869 13:34974154-34974176 AAGAACAATGAAAAGCAGATAGG - Intronic
1107250543 13:38355343-38355365 AAGAATAAGTAAAATGAGATGGG + Intronic
1107375165 13:39796593-39796615 AAAAACAAAGAAAGAGAGACGGG + Intergenic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1107824560 13:44316620-44316642 AAAAACAAGAAAAAGAAAACTGG - Intergenic
1108068942 13:46607624-46607646 AAGAAGAAGGAAGAGGAGGAAGG - Intronic
1108134022 13:47335459-47335481 AAGAAATAGGAAAAGGGGGCCGG - Intergenic
1108596072 13:51950705-51950727 AAAAACAAGGATAATGTGACTGG + Intronic
1108770067 13:53688832-53688854 GGGAAAAAGGAGAAGGAGACAGG + Intergenic
1108801997 13:54109125-54109147 AAAGACAAGGAAAAGGAAAGAGG + Intergenic
1109142041 13:58725497-58725519 AATAACAAGAAAAATGACACAGG + Intergenic
1109693427 13:65923271-65923293 AAAAAAAAGGAAAAGAAGAAAGG + Intergenic
1109776028 13:67042004-67042026 AACAACAAGGAAAGAGAGAATGG - Intronic
1109963251 13:69659357-69659379 AAGAATAAGGAAAAGAATAAAGG - Intergenic
1110030854 13:70611307-70611329 ATGAGCAAGGAAAAGAAAACAGG + Intergenic
1110490332 13:76096051-76096073 AAGAAAAAGGGAAGGGAGGCAGG - Intergenic
1110811437 13:79815227-79815249 AAGGAAAAGGAAAAGGAAAAGGG - Intergenic
1110866307 13:80399758-80399780 ACGACCATGGAATAGGAGACTGG + Intergenic
1111121715 13:83860251-83860273 AAGAAAAAAGAAAAAGAGAAAGG - Intergenic
1111181012 13:84665106-84665128 GATAACAAGGAGAAGAAGACAGG + Intergenic
1111267640 13:85838582-85838604 AAAAAGAAGGTAAAGGAGAAGGG + Intergenic
1111360338 13:87167709-87167731 AAAAACAAGGTAATGGAGAGTGG + Intergenic
1111805117 13:93031185-93031207 AGCAGCAAGGGAAAGGAGACAGG - Intergenic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1112177089 13:97036554-97036576 AAGAAAAAAGAAAAGGGGAGGGG + Intergenic
1112192268 13:97189363-97189385 AAGGAAAAAGAAAGGGAGACAGG + Intergenic
1112201722 13:97283095-97283117 AAGAACTAGGAAAACAACACAGG - Intronic
1112350984 13:98632823-98632845 AAGAAACAGAAAAAGGAGGCCGG - Intergenic
1112371971 13:98802160-98802182 CAGACAAAGCAAAAGGAGACTGG - Intronic
1112449485 13:99495881-99495903 AAAAACAAGGAAAAGGACTCAGG + Intergenic
1112554248 13:100452154-100452176 AAGAAAAAAGAGAAGGAGAGAGG - Intronic
1112661932 13:101520129-101520151 AAGTAGATGGAAAAGAAGACAGG - Intronic
1112744840 13:102514894-102514916 AAGAAGAAGGAAGAGGAGCAAGG + Intergenic
1112914972 13:104537029-104537051 AAGAATAAGAAAAGGAAGACTGG + Intergenic
1112960654 13:105121219-105121241 AAAAAAAAGGAAAAGGAAAAAGG + Intergenic
1113005249 13:105694507-105694529 AAGAGCAAGGAAAGAGAGAGGGG + Intergenic
1113093412 13:106638019-106638041 AAGACCAAGAAAAAAGAGAATGG - Intergenic
1113102215 13:106733123-106733145 AAGAAAAAGAGAAAGGAGAGAGG + Intergenic
1113127650 13:106997976-106997998 AAGAAAAAGCAAAAGGGGAAGGG + Intergenic
1113303875 13:109054965-109054987 AAGAAGGAGGAAAAGGAGGGAGG - Intronic
1113473917 13:110566356-110566378 AAGAAAAGGGAGGAGGAGACGGG + Intergenic
1113477415 13:110594383-110594405 AAGACCAAGGAAAAAGAGTTTGG - Intergenic
1113659563 13:112096304-112096326 TACAATTAGGAAAAGGAGACAGG + Intergenic
1113672434 13:112184150-112184172 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1113835868 13:113328168-113328190 AAGGACAGGGACAAGGAGCCTGG - Intronic
1113916862 13:113879214-113879236 AAGAAACAGTAAAAGGTGACAGG + Intergenic
1114392226 14:22322368-22322390 AAGAAGAAGGAGAAAGAGAAAGG + Intergenic
1114401694 14:22416145-22416167 AAGGACAAGGAGCAGAAGACTGG + Intergenic
1114509250 14:23243397-23243419 AAAAAGAAAGAAAAGAAGACCGG + Intronic
1114661377 14:24347350-24347372 AGAAACAATGAAAAGGAAACAGG - Intergenic
1114671859 14:24415761-24415783 CAGGAGAAGGAAAGGGAGACAGG - Exonic
1114836818 14:26212386-26212408 AAGAAGAAGAAAATGGATACTGG - Intergenic
1114862259 14:26538681-26538703 ATGAACAAGGGAAAGGAGTGGGG - Intronic
1115065328 14:29253238-29253260 AAAAACAAAGAAAAACAGACTGG - Intergenic
1115091540 14:29582915-29582937 AAAAACAAAGTAAAGGAGAAAGG + Intronic
1115204590 14:30888268-30888290 GAGAGTCAGGAAAAGGAGACTGG + Intronic
1115395014 14:32898738-32898760 AAGAAAAAGGAAATGGAAAAGGG - Intergenic
1115529365 14:34312808-34312830 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1115664878 14:35534970-35534992 AAGATCAAGGAGGAGGAGCCCGG + Exonic
1116187205 14:41611555-41611577 AAGAACAAGCATAAGCAGATAGG + Intronic
1116577157 14:46588649-46588671 AGCAAAAGGGAAAAGGAGACAGG + Intergenic
1116699721 14:48224572-48224594 AGGAAGAAAGAAAAGGAGAGAGG + Intergenic
1116808802 14:49519852-49519874 AAGAAGGAAGAAAAGGAGAGAGG + Intergenic
1116949196 14:50863430-50863452 AAGAAAAAGGAAAAAAAGAGTGG - Intronic
1116968702 14:51042331-51042353 AGGAGGAAGGAAGAGGAGACTGG - Intronic
1117275019 14:54184694-54184716 CAGCAAAAGGAAAAGGAGAAAGG + Intergenic
1117721196 14:58630450-58630472 CAGAACAATGAAAAGCAGAGGGG + Intergenic
1117882384 14:60324947-60324969 AAGAAAAAGAAAAAGCAAACCGG - Intergenic
1117931474 14:60846153-60846175 AAGAAAAAGGAATAGGAGAATGG - Intronic
1119018587 14:71085298-71085320 AAGAACAAGAAACAGGTGGCTGG - Intronic
1119345029 14:73916170-73916192 AGGAAGGAGGAAAAGGAGTCTGG + Intronic
1119387795 14:74268686-74268708 AAGAAAAAGGGAAAGGGGAAGGG + Intergenic
1119657312 14:76426227-76426249 AAGAGAGAGGAATAGGAGACAGG + Intronic
1119714001 14:76845338-76845360 AAGAAGAAGGAAAAGAAGAAGGG + Intronic
1119760335 14:77146324-77146346 GAGAAGAGAGAAAAGGAGACAGG + Intronic
1119781721 14:77280329-77280351 AAGAACAAGAGCAGGGAGACCGG - Intronic
1119858569 14:77920112-77920134 AAAAACAAAGATAAGTAGACAGG - Intronic
1120175704 14:81291096-81291118 GAGAAAAAAGGAAAGGAGACAGG + Intronic
1120281459 14:82443675-82443697 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1120451389 14:84671653-84671675 AAGAACAAGGAACAAGATAGTGG - Intergenic
1120520834 14:85526589-85526611 AAGAAAAAGAAAAAGGAAAAAGG - Intergenic
1120532015 14:85643383-85643405 AAAAAAAAGAAAAAGGAGAAAGG - Exonic
1120556526 14:85934546-85934568 CAGAAAAAGGAAAAGGGGAGGGG + Intergenic
1120751156 14:88199498-88199520 AAGAACCTGGAAAAGCAGCCAGG + Intronic
1120873144 14:89355911-89355933 AAGAACGGGGATAAGGAGGCAGG + Intronic
1120880740 14:89413764-89413786 AAGAAGAAGGAAAAAAAGAAGGG + Intronic
1121017123 14:90555631-90555653 AAGGGCAAGGAAAAGGACTCTGG - Intronic
1121276652 14:92672418-92672440 AAGAAAAAGAAAATAGAGACTGG + Intronic
1121476400 14:94210749-94210771 AAGAATAAGGCAAATGAGAAGGG + Intronic
1121552895 14:94815565-94815587 AAGCATAAGGAAAAGGAGCGAGG - Intergenic
1121593270 14:95137180-95137202 AAGGAGAAGGAAAAGGGGAAGGG + Intronic
1121593301 14:95137297-95137319 AAGAAAAAGGAAAAGGGAAAGGG + Intronic
1121683195 14:95811415-95811437 AAGAAGAAGGACAAGGAGCAGGG - Intergenic
1122094626 14:99362064-99362086 AAGAACAGGGCAGAGGAGTCAGG - Intergenic
1122531665 14:102432107-102432129 AAGAAGAAGAAGAAGAAGACAGG + Exonic
1122621645 14:103061128-103061150 AAGAAAAAGAAAAAGAAGGCCGG + Intergenic
1122624333 14:103076433-103076455 AAGAAAAAAAAAAAGGAGCCAGG - Intergenic
1123821133 15:24031522-24031544 CAGAAAAAGGAAAAGGACTCAGG + Intergenic
1123910211 15:24958378-24958400 AAAAAAAAAAAAAAGGAGACAGG - Intronic
1124366540 15:29075712-29075734 AAAAGCAAGATAAAGGAGACTGG - Intronic
1124444364 15:29716090-29716112 AAGCACAGGGAAAAGATGACTGG + Intronic
1124636720 15:31370030-31370052 AAAAAAAAGAAAAAGGAGACAGG - Intronic
1124957855 15:34371202-34371224 AAGGAGAAGGAAGAGGAGATGGG - Intergenic
1125010958 15:34874663-34874685 CAGAGCAAGGTAAAAGAGACAGG - Exonic
1125078585 15:35650369-35650391 AAAAAGAAGGAAGAGAAGACAGG + Intergenic
1125083093 15:35698405-35698427 AAGAAAAAGGAATGGGAAACTGG + Intergenic
1125639790 15:41221002-41221024 AAGAAGAAAGAAGAGGAGGCTGG - Intronic
1125670054 15:41465088-41465110 AAGAAAAAAGAAAAGGAAAAAGG - Intronic
1125754438 15:42053315-42053337 AAGAACAGGGAAAGGAAGCCTGG - Intergenic
1125811313 15:42543881-42543903 AAGAAAAAGGATCAGGAGACAGG - Exonic
1126371004 15:47947070-47947092 AAAAATAAGGAAAAGGAGAAAGG + Intergenic
1126431330 15:48588306-48588328 ATGAAAAAGTAAAAGGAAACAGG - Intronic
1126509203 15:49448301-49448323 AAGAATAAGGAAAAGAAAAGAGG - Intronic
1126561516 15:50048979-50049001 AAAAACTAGGCAAAGGAGAAAGG + Intronic
1126561777 15:50052044-50052066 AAAAACAAAGAAAAGTAGACTGG - Intronic
1126891645 15:53211625-53211647 ACAAACAAGGCAAAGGAGTCAGG + Intergenic
1127012008 15:54641805-54641827 GAGAATGAGGAAAAGCAGACTGG + Intergenic
1127087384 15:55437110-55437132 AAGAACAAGGTAATAGAGCCAGG - Intronic
1127222166 15:56891292-56891314 CAGAAGAGGGAAAAAGAGACTGG - Intronic
1127243950 15:57150946-57150968 AAGGAAAAGGAAAAGGGGAGGGG - Intronic
1127285848 15:57533067-57533089 AAGAATACGGAAAAGCAGCCAGG - Intronic
1127389114 15:58491080-58491102 AAGAACAGGTAAAGGGAGCCTGG + Intronic
1127392041 15:58513592-58513614 AGGAAAAAGGAAGAGGAAACAGG + Intronic
1127415888 15:58756824-58756846 AAGAAACAGAAAAAGAAGACAGG - Intergenic
1127674907 15:61229342-61229364 AAAAAGAAGGAGAAGGCGACCGG + Intergenic
1127691055 15:61398366-61398388 AAAAACAAGGAGAAGGAAAGTGG + Intergenic
1127842767 15:62845294-62845316 AAGAACAACAAAAATGAGATTGG + Intergenic
1128366000 15:67003529-67003551 AAAAAAAAAAAAAAGGAGACAGG + Intergenic
1128504289 15:68255780-68255802 AAGAAAAAGTAAAAAGAAACAGG - Intronic
1128557466 15:68641479-68641501 AGGAGCAGGGAAAAGGAGAAGGG + Intronic
1128711701 15:69876928-69876950 TCGAAAAAGGAAAGGGAGACAGG + Intergenic
1128743808 15:70100084-70100106 AAGAAGAAGGAAAAGAAAAGAGG + Intergenic
1128882338 15:71255198-71255220 AATCAGAAGGAAAAGGAGCCTGG - Intronic
1128937684 15:71761701-71761723 AAGAACCAGGAAGAAGACACAGG - Intronic
1128975725 15:72151851-72151873 TAGAACAAGAAAAGGGAGATTGG - Intergenic
1129149242 15:73677312-73677334 AAGAACTTGGAAAAGGAGTAGGG + Intergenic
1129227475 15:74178549-74178571 AAGAACAGGGAAAGGGTGCCTGG - Intergenic
1130193497 15:81758233-81758255 AAGATCAAAGAAATGGAGAGGGG - Intergenic
1130559963 15:84950351-84950373 AAAAAAAAAAAAAAGGAGACTGG - Intergenic
1130751433 15:86717207-86717229 GAGAACAAGGAGAAGGAGTGGGG + Intronic
1130759250 15:86800815-86800837 GAGAATAAAGAAATGGAGACTGG + Intronic
1131081397 15:89539248-89539270 AAGGAAAAGGAAAAGGAAAAGGG + Intergenic
1131282078 15:91029878-91029900 AAGTTCTAGGACAAGGAGACTGG + Intergenic
1131465888 15:92654812-92654834 AAGAAGAAGAAAAAGTAGGCGGG + Intronic
1131512684 15:93057919-93057941 AGGAACAAGGACATAGAGACTGG - Intronic
1131635512 15:94229604-94229626 TGGAACATAGAAAAGGAGACAGG + Intergenic
1132053681 15:98633288-98633310 AATAACAAGGAAGATGAGGCAGG + Intergenic
1132298983 15:100764918-100764940 GAGAAGGAGGAAAAGGAGGCCGG - Intergenic
1132308308 15:100834899-100834921 AAGAGGAAGGGAAAGCAGACAGG + Intergenic
1133491229 16:6271125-6271147 AAGAACATAGAAAAAGAGGCCGG + Intronic
1133830146 16:9315502-9315524 AGGAAAAAGGAAAAGAAGAAAGG - Intergenic
1133846711 16:9461049-9461071 AAGAAGGAGGAAAAGGATGCAGG + Intergenic
1134068687 16:11247068-11247090 AAAAAAAAGGAGAAGGAGAAGGG - Intergenic
1134120494 16:11580752-11580774 AAGAAAAAGGAATAGGGGCCTGG - Intronic
1134237924 16:12482282-12482304 AAGGAAAAGGAAAAGGAAAAAGG - Intronic
1134896930 16:17896673-17896695 AGGAAAAAGAAAAAGGAGAAAGG + Intergenic
1134904841 16:17971519-17971541 AAGAAGATGGAAGAAGAGACAGG + Intergenic
1135064732 16:19299926-19299948 AAGAATAAGGAAAGGGGGCCAGG + Intronic
1135232064 16:20717865-20717887 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
1135470052 16:22722085-22722107 AAAAAGAAGGAAAAGTGGACTGG + Intergenic
1135470591 16:22726268-22726290 AAGAAAAAGAAAAAGGAAGCGGG - Intergenic
1135805740 16:25540859-25540881 AAAAAGAAGGAAAAGGATTCTGG + Intergenic
1135898637 16:26434171-26434193 AAGAAAAAGGAAAAGAAAAAGGG - Intergenic
1135942428 16:26834220-26834242 AAGAAGAAGGAAGAGGAGGGAGG + Intergenic
1135965352 16:27030670-27030692 AGGAAAATGCAAAAGGAGACTGG + Intergenic
1136012549 16:27373264-27373286 AAGACCTTGGAAAAAGAGACTGG - Intergenic
1136042105 16:27587886-27587908 AAGAAAAAGGAAAGGGAAAAGGG - Intronic
1136096707 16:27962165-27962187 AAGAACAAGAGAATGGACACAGG - Intronic
1136356308 16:29746575-29746597 AAGAAAAAGAAATAGGACACTGG + Intergenic
1136464452 16:30432626-30432648 AAGAAAAAAGAAAAAGAGAATGG - Intergenic
1136599359 16:31274313-31274335 AAGAAAAAGAAAGAGGAGAAAGG + Intronic
1136901116 16:34038894-34038916 AAGAAAGAGGAAAAGAAGAAAGG + Intergenic
1136939665 16:34510988-34511010 AAGAAGGAGGAAAAGGAGGGCGG - Intergenic
1136960155 16:34837572-34837594 AAGAAGGAGGAAAAGGAGGGCGG + Intergenic
1137030117 16:35515497-35515519 AATCACAAGCAAAAGGAAACTGG + Intergenic
1137377251 16:47962801-47962823 TAGAACAAGAAAAATGAGACTGG + Intergenic
1137543031 16:49377770-49377792 AAGAAGAAGGAAGAGAAGAAAGG + Exonic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137772089 16:51024543-51024565 AAAAACAAAGAAAAGGAAAATGG + Intergenic
1137780811 16:51096303-51096325 AAAAACAACCAAATGGAGACAGG + Intergenic
1137827187 16:51509047-51509069 AACAACAAGAAATGGGAGACTGG - Intergenic
1137910232 16:52370573-52370595 AAGAATAAGGAAATGCAGACAGG - Intergenic
1138148536 16:54634277-54634299 ATGAACAATGAAAAGGGGTCAGG + Intergenic
1139232192 16:65294432-65294454 CAGAAAACGGAAAAGGAGAGTGG + Intergenic
1139449578 16:67018736-67018758 AAGAAAAAAGAAAAGGAGGCAGG + Intergenic
1139461518 16:67126565-67126587 AAAAACAAAGAAAACCAGACTGG - Intronic
1140067000 16:71620052-71620074 AACAACAACAAAAAAGAGACTGG + Intergenic
1140188084 16:72792239-72792261 AGGAGCAAGGAAAAGGAAATGGG + Intronic
1140289535 16:73639790-73639812 ACACACAAGGAAAAGGAAACTGG + Intergenic
1140347175 16:74225216-74225238 GATAAGAAGGAAAAGAAGACAGG + Intergenic
1140437307 16:74958235-74958257 AAAGACAAAGAAAATGAGACAGG + Intronic
1140563543 16:76012227-76012249 AACAAAAAGGTAAAGGAGACTGG - Intergenic
1141031061 16:80589001-80589023 AAGAGGAAGGAGAAGAAGACTGG + Intergenic
1141193759 16:81843939-81843961 AAGAAAAACGAAAAGGAAAAAGG - Intronic
1141193813 16:81844287-81844309 AAGAAAAATGAAAAGGTGCCCGG - Intronic
1141202850 16:81910892-81910914 AAGAAAAGAGAAAAGGACACAGG - Intronic
1141245499 16:82303042-82303064 ATGAACTAGGAAGAAGAGACTGG - Intergenic
1141549614 16:84796766-84796788 AAAAAAAAGAAAAAGGAGGCTGG - Intergenic
1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG + Intronic
1203113788 16_KI270728v1_random:1469540-1469562 AAGGAAAGGGAAAAGGAGAAGGG - Intergenic
1142607385 17:1089661-1089683 AAGAAGAAGGAAATGCAGGCCGG + Intronic
1142872726 17:2831371-2831393 AAGAAAAAGAAATAGGAGGCTGG - Intronic
1143019937 17:3912110-3912132 AAGAGCCAGGAAAGGGAGATAGG + Intronic
1143189158 17:5029092-5029114 AATAAAAGGGAAAAGGTGACTGG - Intergenic
1143368339 17:6422794-6422816 ATGGACAGGGCAAAGGAGACTGG + Intronic
1143540570 17:7566043-7566065 AAGAAAAAGAAAAAGGCCACCGG + Intronic
1143638991 17:8184653-8184675 AAGAAAAAAGAAAAAGAGACTGG + Intergenic
1143770198 17:9163613-9163635 AAAAAAAATTAAAAGGAGACGGG + Intronic
1143876923 17:9998682-9998704 AAGGAAAAGGAAAAGGAAAAGGG + Intronic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144722757 17:17483640-17483662 AAGAATGAGGAAAGGGAGGCTGG + Intronic
1145709141 17:26952741-26952763 AAGAAAGAGGAAAAGAAGAAAGG + Intergenic
1145983455 17:29028106-29028128 AAAATCAAGGAAAAGGGGAGAGG + Intronic
1147400687 17:40178424-40178446 AAGGGCAAGGAAGAGGAGCCGGG - Intronic
1147604442 17:41766315-41766337 AAGGAAAAGGAAAAGGAAAAAGG + Intronic
1148045449 17:44741136-44741158 AAAAAAAAAGAAAAGTAGACAGG + Intronic
1148118443 17:45192425-45192447 AAGAAAAAAGAAAAGGAGGAAGG - Intergenic
1148319250 17:46736216-46736238 AAGAAGTAGGAAGTGGAGACAGG + Intronic
1148475927 17:47928490-47928512 AATAACAAGGAAAGGAAGAAGGG - Exonic
1148600293 17:48889185-48889207 AACAACAACAAAAAGGAGAGTGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148717336 17:49725104-49725126 AAGAAAAAGGAGAGGGAGATGGG - Intronic
1149107109 17:52982657-52982679 AAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1149182229 17:53952912-53952934 AAGAGCAAAGAAAAGGAGCCAGG + Intergenic
1149195154 17:54110747-54110769 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1149309487 17:55380133-55380155 AAGAAAAAGGAAAAGAAGGTAGG + Intergenic
1149392672 17:56207738-56207760 AAGAGAAAGAAAAAGGAGAGAGG - Intronic
1149395696 17:56240209-56240231 AAAAACAAGGATAAGCATACAGG - Intronic
1150257258 17:63757384-63757406 AAAAAAAAGGAAAAGAAAACAGG + Intronic
1150587130 17:66529031-66529053 AACAACAAGAAAAAAGAAACTGG - Intronic
1150848426 17:68682346-68682368 AAAGACATGGAAGAGGAGACTGG - Intergenic
1151001775 17:70385108-70385130 ATGAACAATGAAAAGGTAACGGG + Intergenic
1151161799 17:72172211-72172233 CAGAGCAAAGAAAAGGAAACTGG - Intergenic
1151198823 17:72452775-72452797 AAGAAGAAGGAATAGGTGAGTGG + Intergenic
1151282897 17:73089732-73089754 AAGGACAAGCAAAAGGACCCAGG + Intronic
1151383570 17:73741756-73741778 GAGAAAAAGAAAAAGGAGGCAGG - Intergenic
1151441489 17:74132193-74132215 AAGAGGAAGGAAGAGGAGAGAGG + Intergenic
1151488217 17:74415564-74415586 AACAACAACAAAAAAGAGACTGG + Intergenic
1151825930 17:76524227-76524249 AAGAAAAAGGAAAAGAAAAGAGG - Intergenic
1151938148 17:77276327-77276349 AATAAAATGGAAAAGGAGAGAGG - Intergenic
1153118368 18:1688872-1688894 CAGAAAAAGAAATAGGAGACAGG - Intergenic
1153636069 18:7115007-7115029 AAGAAGAAGGAAAAAAAGAATGG + Intronic
1153643059 18:7172244-7172266 AAAAGCAAGGAGAAAGAGACAGG + Intergenic
1153692726 18:7609512-7609534 AAAAAAAAAAAAAAGGAGACAGG - Intronic
1154241128 18:12655054-12655076 AAGAAAAAGAAAAGAGAGACTGG + Intronic
1155035673 18:22022930-22022952 AAGAAAAAGGGAAAGAAGTCGGG + Intergenic
1155469645 18:26177671-26177693 AAGAACAAAGAAAAGAGGAAAGG + Intronic
1155525645 18:26713769-26713791 AAGAATAGGGACCAGGAGACAGG + Intergenic
1155766138 18:29635397-29635419 AAGAGCAGGGAAAAGGAGCAGGG - Intergenic
1155788606 18:29934142-29934164 CAGAAAAAGGAAAATAAGACAGG + Intergenic
1155822284 18:30392664-30392686 AAAATCAAGGAAAAGAAGAATGG + Intergenic
1155914408 18:31541918-31541940 AAAAACAAGGAAGAGGGAACTGG - Intronic
1156154292 18:34283226-34283248 AATAGAAAGGAAAAGGAGATAGG + Intergenic
1156291044 18:35748731-35748753 AAGAAAGAGGAAAAGGAGATGGG - Intergenic
1156344895 18:36247907-36247929 AAGAACAGTGGATAGGAGACAGG - Intronic
1156512584 18:37653571-37653593 AAAAAAAAGGAAGAGGAGATGGG - Intergenic
1156592321 18:38504994-38505016 AAGAAGAAACAAAAGGAGAGGGG - Intergenic
1156723816 18:40103313-40103335 AAGAAAGAAGAAAAGGAGAGAGG - Intergenic
1156787678 18:40935176-40935198 AAGAATGAGGAAAAGAAGTCAGG + Intergenic
1156862752 18:41857237-41857259 AGGAAGAAGTAGAAGGAGACGGG + Intergenic
1157237607 18:45979194-45979216 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1157365971 18:47064568-47064590 AATAGCAAAGAAAAGGAGATGGG + Intronic
1157651570 18:49337844-49337866 AAGAACAAGAAGAAGGGGAAGGG + Intronic
1157849485 18:51034545-51034567 AAGAAAAAGGAAAAAAAGGCTGG - Intronic
1158109820 18:53928776-53928798 AAAAAAAAAGAAAAGGAGAGGGG + Intergenic
1158177587 18:54674793-54674815 ATGAAACATGAAAAGGAGACAGG + Intergenic
1158245812 18:55430983-55431005 AAGCAAAGGGAAAAGGAGTCAGG + Intronic
1158279856 18:55812670-55812692 AAAAACATGAAAAAGAAGACAGG + Intergenic
1158436272 18:57437133-57437155 AAGAAAAAGAAAAGGGAGAAGGG - Intronic
1158920031 18:62181706-62181728 AATAAAAAGGAGAAGGCGACTGG - Intronic
1158952732 18:62510361-62510383 AAAAAAAAAGAACAGGAGACAGG + Intergenic
1159049360 18:63404340-63404362 AGGGAGAAGGAAAAGGAGAGAGG + Intronic
1159149575 18:64504257-64504279 AAAAAGAAGGAAAAGCAGGCAGG - Intergenic
1159699708 18:71609627-71609649 AAGTGAAAGGAAAATGAGACAGG - Intergenic
1159885583 18:73901263-73901285 AAGAAAAAGCAAAAGGAGCTTGG - Intergenic
1159927381 18:74281445-74281467 GAGAAGTGGGAAAAGGAGACAGG + Intronic
1159964642 18:74583452-74583474 ATTAACAAGGAAAAAGAGAGAGG + Intronic
1160109732 18:76015035-76015057 AATAACATGGAAAAAGAGACAGG - Intergenic
1160734570 19:656657-656679 AAGAAAAAGGGAAAGGGGAAGGG + Intronic
1160804418 19:985741-985763 GAGAACCAGGAAGAGGAGTCGGG - Intronic
1161128088 19:2571386-2571408 CAGAACAAGGATAAGGATATAGG - Intronic
1161172283 19:2818712-2818734 AAGAACAAAGAATAGGTGGCCGG + Intergenic
1161202540 19:3023915-3023937 AAGAAAAAGAAAAAAGAAACAGG + Intronic
1161274130 19:3405896-3405918 AAGAAAAAGAAAAAGGGGCCGGG - Intronic
1161359537 19:3839759-3839781 AAGAAAAAGGAATAGGATCCAGG - Intronic
1161366940 19:3885564-3885586 AAGAAGAAGGAGAAGGAGAGAGG + Intronic
1161564032 19:4989635-4989657 AAGAAGAAGAAGAAGAAGACTGG - Intronic
1161564939 19:4996714-4996736 AAGAACCAGCACGAGGAGACAGG - Intronic
1161630718 19:5353980-5354002 AGGAACATGGAACAGGAAACAGG + Intergenic
1161647589 19:5463381-5463403 AAGGAGAAGGAAAAGAAGAAAGG - Intergenic
1162011682 19:7820138-7820160 AAGAAAAAAGAAAAGAAGAAAGG + Intergenic
1162226307 19:9225500-9225522 AAAAACAACAAAAAGGAGAGGGG + Intergenic
1162234555 19:9297719-9297741 AAGAACAAGGAAAATGCGAGAGG + Intronic
1162389557 19:10381013-10381035 AGAAACGAGGGAAAGGAGACAGG - Intergenic
1162454900 19:10777584-10777606 AACAAAAAGGAAAAGGAAAAGGG - Intronic
1162871088 19:13587333-13587355 AAGAAGAAGAAAACGAAGACAGG + Intronic
1162885770 19:13695922-13695944 AAGAAAAAAGAAAGGCAGACAGG + Intergenic
1163462828 19:17448885-17448907 TAAAACAAGAAAAAGGAGGCCGG + Intronic
1163498715 19:17662929-17662951 AAAAAAAAGGAAAAGGAAAATGG + Intronic
1163658322 19:18561254-18561276 AAAAACAAGGTAAAGTAGCCTGG + Intronic
1163669974 19:18621723-18621745 AAGAAAAAGAAAAAGTAGACCGG - Intergenic
1163673249 19:18641612-18641634 AAGAAAAAAGAAAAAGAGCCGGG - Intronic
1163689233 19:18729845-18729867 AAGAACGAGGATAAGGAGTGTGG - Intronic
1163703053 19:18796068-18796090 AAAAAAAAAAAAAAGGAGACTGG - Intergenic
1163729870 19:18942652-18942674 AAGGAACAGGGAAAGGAGACAGG - Intergenic
1163744524 19:19037365-19037387 AAAAAAAAGGAAAAAGAAACAGG - Intronic
1163998570 19:21076136-21076158 AAGAAAAAAGAAAAAGAGGCCGG - Intergenic
1164211927 19:23106145-23106167 AAGCAGAAGGAGAAGGAGAAGGG + Intronic
1164588505 19:29493077-29493099 AATCACAAGGAAAAGGAAACTGG + Intergenic
1164809403 19:31144193-31144215 AAGATCGTGGAGAAGGAGACAGG + Intergenic
1164839257 19:31380361-31380383 AAGAAGGAGGAAAGGGAGGCTGG - Intergenic
1164858312 19:31542575-31542597 AAGAAGAAGAAGAAGAAGACAGG - Intergenic
1165050290 19:33137089-33137111 AAGAAGAAAGAAAATGAGCCAGG - Intronic
1165066308 19:33230845-33230867 GAGAACAGGGAAAATGAGGCAGG - Intergenic
1165256704 19:34580603-34580625 ATGAATAAGGAAAAAGGGACAGG - Intergenic
1165351984 19:35280510-35280532 AATAGCTAGGAAAAGGAGACAGG - Intergenic
1165486260 19:36098268-36098290 AAAAAAAAAGAAAAAGAGACCGG + Intronic
1165750110 19:38254294-38254316 AAGAAAAAAGAAAAAGAGATGGG - Intronic
1165776703 19:38408871-38408893 AAGAAGAAGTAAAGGGGGACTGG + Exonic
1165936670 19:39393390-39393412 AAAAAAAAAGAAAAGGAGGCTGG - Intronic
1165954994 19:39496968-39496990 AAATACAGGGAAAAGGAGCCTGG + Intergenic
1166197137 19:41214480-41214502 AAGAAAAAGGAAAAGAAAGCAGG - Intergenic
1166303173 19:41923550-41923572 ATGGACAGGGACAAGGAGACAGG + Intronic
1166617973 19:44268332-44268354 AAGAAAAATGAAAAGAAAACAGG - Intronic
1166674950 19:44734663-44734685 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1167406122 19:49309919-49309941 AAGAAGAAGGAAAAAGAAATGGG - Intronic
1167627624 19:50603179-50603201 AAGGAGAAGGAGAAGGAGAGGGG - Intergenic
1167633023 19:50637586-50637608 AGGAAGAAGGACAAGGTGACAGG + Exonic
1167702110 19:51054962-51054984 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1167726094 19:51213830-51213852 AAGAAAAAGAAAAATGAGGCTGG - Intergenic
1167810152 19:51822769-51822791 AGGGACAATGAAAAGCAGACGGG + Intronic
1167834899 19:52060481-52060503 AAAAACGAGGAAAAGGACTCAGG - Intronic
1167837302 19:52084803-52084825 AAGAAGAAAGAAAAGGAGCCAGG - Exonic
1167846357 19:52168074-52168096 AAGAGGAAAGAAAAGGAGTCAGG - Exonic
1167880956 19:52456924-52456946 AAGAGGAAAGAAAAGGAGTCAGG + Exonic
1167888593 19:52522152-52522174 AAGAGGAAAGAAAAGGAGCCAGG + Intergenic
1167896842 19:52588575-52588597 AAGGGCAAAGAAAAGGAGCCAGG + Intergenic
1167921817 19:52788352-52788374 AGGAGCAAAGAAAAGGAGCCAGG - Intronic
1167942090 19:52956043-52956065 AAGAGCAAAGAAAAGGAGCCAGG - Exonic
1167944980 19:52980907-52980929 AAGAGCAAAGAAAAGGAGCCAGG - Intergenic
1167958349 19:53086278-53086300 AAGAGGAAAGAAAAGGAGTCAGG - Exonic
1167969923 19:53182900-53182922 AAGAGGAAGGCAAAGGAGTCAGG - Exonic
1168078401 19:53992600-53992622 AAGAACTTGGCAAAGAAGACGGG - Exonic
1168103540 19:54153521-54153543 CAGGAGAAGGAAAATGAGACAGG - Intronic
1202697439 1_KI270712v1_random:135299-135321 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
925328942 2:3043442-3043464 AAGAAGGAGGAAAAGGAGAGCGG + Intergenic
925515087 2:4673221-4673243 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
925704699 2:6673367-6673389 AAGCAGAAGGAAAAGGAGAAGGG + Intergenic
925765886 2:7234898-7234920 AAAAAAAAGGAAAAGAAGAAGGG + Intergenic
925819903 2:7790057-7790079 AAGAACATGGAAAAGGCTCCAGG - Intergenic
926247242 2:11130474-11130496 AAGGACATGTAAAAAGAGACTGG + Intergenic
926270054 2:11358747-11358769 AAAAAAAAGGAAAAGGAAAACGG + Intergenic
926289926 2:11520616-11520638 AAGAAGGAGGAAAAGGAAAGAGG - Intergenic
926472465 2:13278306-13278328 AAGAACAAGTACAAGAAAACTGG + Intergenic
927353078 2:22141597-22141619 GAGGAGAAGGAAAAGGAAACAGG + Intergenic
927649284 2:24901792-24901814 AAGAAGAAGGAAAAAGAAAAAGG + Intronic
927724341 2:25409750-25409772 AAAAAGAAGAAAAAGGAGGCAGG - Intronic
927866180 2:26589159-26589181 AGGAAGAAGGAGAAGGAGAAGGG - Intronic
927928980 2:27032183-27032205 AAGAACAAGGAAGAGGATGGGGG - Intergenic
928252246 2:29691383-29691405 AAGAGCTTGGTAAAGGAGACTGG + Intronic
928455201 2:31414511-31414533 CAGAACAAGTAAGAGGGGACAGG + Intronic
928831627 2:35492754-35492776 GAGAACAAAGAAAAGCATACAGG - Intergenic
929149621 2:38735896-38735918 AAGAAAAAGAAAAAAGAAACTGG + Intronic
929222130 2:39475886-39475908 AGGAACAGAGAAAAGGAGAGAGG - Intergenic
929352283 2:40971767-40971789 AAAGACAAGAAAAAGAAGACGGG + Intergenic
929648162 2:43650630-43650652 AAGAAAAAAGAAAAGAAGAAAGG - Intronic
929766454 2:44847928-44847950 AAGAAGGGGGAAAAGGAGAAGGG - Intergenic
929956473 2:46462256-46462278 AAGAAGAAGGAAAACAAAACAGG + Intronic
930044137 2:47154382-47154404 CAGAATAAGGAAAATGAGATGGG + Intronic
930218370 2:48720518-48720540 AAGTGCCAGGACAAGGAGACAGG - Intronic
930357910 2:50345182-50345204 GAGAACTAGGAGAAGGAGAAAGG + Intronic
930431616 2:51284120-51284142 AAGAACAGGTAAAAGGTTACCGG + Intergenic
930766252 2:55088770-55088792 AGGAACACAGAAAAGGAGAGAGG + Intronic
930989717 2:57638315-57638337 AAGATGAAGGAAAAGGAGGTAGG + Intergenic
931007196 2:57865234-57865256 AAGAAAGAGGAAGAGGAGAATGG + Intergenic
931067008 2:58598604-58598626 AAAAAAAAGGAAATGGAGATAGG - Intergenic
931090945 2:58885422-58885444 AAAAACAAGAAAAGGGAGATAGG - Intergenic
931380230 2:61746059-61746081 AAGAAGAAGGAGAAGAAGAAAGG + Intergenic
931662316 2:64577149-64577171 AAGAACAAAAACATGGAGACAGG - Intronic
931965721 2:67532006-67532028 CAGACCAAAGGAAAGGAGACTGG + Intergenic
932099416 2:68883907-68883929 AAGGAGAAAGAAAAGGAGAAAGG - Intergenic
932600081 2:73117879-73117901 AAGAAAAAGAAAAAGAAGGCCGG + Intronic
932606360 2:73168423-73168445 AAGAAAAAAGAAAAGAAGAAAGG + Intergenic
932672321 2:73748962-73748984 AAGAAAAAGAAAAAGGACGCTGG - Intergenic
933484413 2:82899829-82899851 AACAACAAAGAAAAGAAAACTGG - Intergenic
933821779 2:86119346-86119368 AAAAAAAAGGAAAAGGGTACAGG - Intronic
933926070 2:87092019-87092041 AAGAAAAAAGAAAAGAAGAAAGG - Intergenic
934037938 2:88104284-88104306 AAGAAGGAGGAAGAGGAGAAGGG - Intronic
934097771 2:88623315-88623337 AAGAACATGGACAACGAGATTGG + Intronic
934174317 2:89565820-89565842 AAAAAGAAGGAAAAGAAGAACGG - Intergenic
934278608 2:91592324-91592346 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
934284632 2:91640170-91640192 AAAAAGAAGGAAAAGAAGAACGG - Intergenic
934918294 2:98319217-98319239 AAGAAAAAAAAAAAGCAGACAGG + Intergenic
935362138 2:102254585-102254607 AAGAACGAGGAGAGGGAGAAGGG + Intergenic
935782262 2:106518721-106518743 AAGTAGAGAGAAAAGGAGACAGG - Intergenic
935887588 2:107639582-107639604 AAGAAAAAGGTAATGGAGAGTGG - Intergenic
936395903 2:112129776-112129798 AAGAAAAAGAAAAAAGAGCCGGG + Intergenic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
936589081 2:113785724-113785746 CAGAAGAAGGAAAAGGAGTGAGG - Intergenic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937664151 2:124465166-124465188 AAGATCAAAGAAAAAGAGAGTGG + Intronic
937732633 2:125252865-125252887 AAGAACATGAAAAACTAGACTGG - Intergenic
937734087 2:125268622-125268644 GTGATAAAGGAAAAGGAGACAGG - Intergenic
937817246 2:126264728-126264750 AAGAAAAAAGAAAAGGAAAAAGG + Intergenic
937817273 2:126264896-126264918 AAGAAGAAAGGAAAGGAGAAAGG + Intergenic
937943741 2:127311878-127311900 AAGAAAAAAGAAAAGGAGATTGG - Intronic
938145587 2:128832499-128832521 AAGAAAAAAGAAAAGGAGGGAGG - Intergenic
938519113 2:132048565-132048587 AAGAAAGAGGAAAAGAAGAAAGG - Intergenic
938709140 2:133960404-133960426 AAGAAAAAGAAAAAAGAGGCTGG - Intergenic
939059828 2:137408321-137408343 AAGATCAAGATAAAGGAGAAGGG - Intronic
939136065 2:138295781-138295803 AAGAAAAAGGAAGAGGAGGAGGG - Intergenic
939379808 2:141420547-141420569 AAGAACAAGGAAGAGCAGAGTGG - Intronic
939683170 2:145164065-145164087 TCGAAAAAGGAAAATGAGACTGG - Intergenic
939749570 2:146026522-146026544 GAGAAGATGGAAGAGGAGACAGG - Intergenic
939928608 2:148204041-148204063 AGGAAGAAAGAAAAGGAGAGAGG + Intronic
940037268 2:149324045-149324067 ACGACCATGGAACAGGAGACTGG + Intergenic
940345333 2:152622875-152622897 AAGAACAAAAAAAAGGTGCCAGG + Intronic
940719170 2:157262662-157262684 AATAAAAAGGTAGAGGAGACAGG + Intronic
940966247 2:159840018-159840040 AAGAAAAAGAAAAAAGAGAAAGG + Intronic
941196866 2:162463327-162463349 AGGAAGGAGGAAAAGGAGAGAGG - Intronic
941483885 2:166054020-166054042 AAGAAGAAAGAAAAGGGGTCAGG + Intronic
941496863 2:166215786-166215808 AAAAAAAAGGAAAAGGTCACTGG + Intronic
941561724 2:167054691-167054713 AAAAAAAAGGAAAAGGAAACAGG + Intronic
941756291 2:169189909-169189931 ACGAACAAAGAAAGGGAGAGAGG + Intronic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942251818 2:174053807-174053829 AAGAAAAGGGGAAGGGAGACAGG + Intergenic
942422566 2:175823010-175823032 AAAAACAAGTAAATGGAAACAGG + Intergenic
942582194 2:177430642-177430664 GAGAACAAAGAAAAGGAGGGTGG - Intronic
942692255 2:178598512-178598534 AAGAAGAAGGAAAAGAAGAATGG - Exonic
942702080 2:178723554-178723576 GAGAACTAGTGAAAGGAGACCGG - Exonic
942877840 2:180823793-180823815 AAGATCAAGGAAGAGGCAACAGG + Intergenic
943020420 2:182565943-182565965 AAGAAAAAGAAGAAAGAGACAGG + Intergenic
943342307 2:186695062-186695084 AAGGAAAGGGAAAAGGAGAGGGG + Intronic
943400818 2:187408857-187408879 AAGCACAGAGAAAAGGAGAATGG - Intronic
943653485 2:190482225-190482247 AAGTCCAATGAACAGGAGACAGG - Intronic
943690193 2:190861713-190861735 AAGAAGTAGGAAAAGGATGCTGG + Intergenic
943920050 2:193694736-193694758 AGGAAAAGGGAAAGGGAGACCGG + Intergenic
943921538 2:193713269-193713291 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
944105226 2:196072424-196072446 AGGAAAAAGTAAAAGGAGATAGG + Intergenic
944329120 2:198445007-198445029 AAGAAAAACGAAAAGGAAAAAGG - Intronic
944517716 2:200528949-200528971 CAGATCAAGTAAAAAGAGACTGG + Intronic
944654998 2:201868469-201868491 AAGAGGAAGGAAAAGCAGATAGG + Intronic
944999564 2:205333821-205333843 AATAACAAGGAAAAAAAAACAGG - Intronic
945463626 2:210141187-210141209 AAGAAAAAAGAAAAAGAGAAAGG - Intronic
945582377 2:211611312-211611334 CAGAAAAAGGAAAAGGGGAGGGG + Intronic
945657259 2:212640282-212640304 ACAAATAAGGAAAAGGAGAATGG - Intergenic
946182387 2:217956442-217956464 AAGAACAAAGAAATAAAGACAGG + Intronic
946243267 2:218369780-218369802 AAGAAAAAGGAAATTGAGGCTGG - Intergenic
946592166 2:221262605-221262627 AGGAACAAGGAAGAGAAGAAAGG - Intergenic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
946814692 2:223564882-223564904 AATAACAAGAAAAAGGGGCCGGG + Intergenic
946934815 2:224709040-224709062 AAGAAAAAGAAAAAGAAGCCAGG - Intergenic
947601377 2:231452751-231452773 AAGAAAAAGAATCAGGAGACAGG + Exonic
947698544 2:232213373-232213395 AAGGACATGGAAAAGGAGTCAGG + Intronic
947783493 2:232792588-232792610 AACAACAACAAAAATGAGACAGG + Intronic
947970923 2:234323842-234323864 AAGAAAAAGAAAAAGAAAACTGG - Intergenic
948236122 2:236391968-236391990 AAGAAAAAGGACAAGGTGAGTGG - Exonic
948283267 2:236764951-236764973 ATGAACAGGGAAAAGGAAACTGG - Intergenic
948514227 2:238493447-238493469 AAGAAAAAGAAAAAGAAGAAGGG - Intergenic
948539007 2:238672382-238672404 GAGAAGAAGGAGAAGGAGAAGGG - Intergenic
948558597 2:238835356-238835378 AAAAAGAAGGAGAAGGAGAAGGG - Intergenic
948857651 2:240737540-240737562 AATAACAAGGAAAGGGAGGGAGG + Intronic
949008770 2:241666872-241666894 AAGAACTGGGAGAAGGGGACGGG - Intronic
949080199 2:242089979-242090001 TAAAACAAGGAAAACAAGACAGG - Intergenic
1169052960 20:2595960-2595982 AAGGAAAAGAACAAGGAGACAGG + Intronic
1169098677 20:2926755-2926777 AAAAAAAAGGAAAAGGAAAAAGG - Intronic
1169118014 20:3079087-3079109 AAGAACAAGTAATAGGAGGCTGG - Intergenic
1169369400 20:5016983-5017005 AAAAAAAAAGAGAAGGAGACAGG - Intergenic
1169434857 20:5577497-5577519 AAAAAAAAGGAAAAGAAGAAAGG + Intronic
1169717365 20:8635301-8635323 AAGGAAAAGGAAAAGGAAAAGGG + Intronic
1169850927 20:10049809-10049831 AAGAAAAAGGAAAAAGGGATGGG + Exonic
1170139114 20:13107600-13107622 AAAAACAAAGAAAAGGAAAGTGG + Intronic
1170306354 20:14942441-14942463 AAGAAAAAGGAGGAGGAGAAAGG - Intronic
1170311474 20:14997151-14997173 AAGGAGAAGGAAAAGGAGTGGGG + Intronic
1170333378 20:15240574-15240596 AAGAAGAAGAAAAAGGAAAATGG + Intronic
1170336677 20:15277797-15277819 AAGAAGAAAGAAAGGGAGAGAGG + Intronic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1170583566 20:17716883-17716905 AAGAAAAAGAAAAGAGAGACGGG + Intronic
1170658658 20:18315319-18315341 AAGAACCAAGAAAAGGACTCTGG + Exonic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1172240346 20:33408722-33408744 AAAATCCAGGAAAAGGAGACTGG + Exonic
1172488670 20:35316630-35316652 AAGAAAAAGGAAATGGACTCAGG - Intronic
1172576042 20:36009529-36009551 AAGAAAAAGAAAAAGGAAACAGG + Intronic
1172643162 20:36453972-36453994 AAGAAAAAGAAAAAAGAGTCCGG + Intronic
1172775920 20:37406802-37406824 ATGGACAAGGAAGAGGAGAGAGG - Intergenic
1173395963 20:42679969-42679991 TAGAACAAGGAAGAGGAGAAAGG + Intronic
1173858323 20:46265775-46265797 AAGAAGAAGAAAAAGGAGAATGG - Intronic
1174021459 20:47533486-47533508 AAGAACAAAGAAAAAAAGACTGG - Intronic
1174045656 20:47730815-47730837 AAGAATAAGGAAAAGCATACTGG - Intronic
1174212546 20:48891341-48891363 AAGAACAAGAACAAGAAGAAGGG + Intergenic
1174212563 20:48891520-48891542 AAGAACAAGAACAAGAAGAAGGG + Intergenic
1174273395 20:49385691-49385713 AGCAAGGAGGAAAAGGAGACAGG - Intronic
1174406435 20:50306166-50306188 ATGAAGCAGGAAAAGGAGATGGG + Intergenic
1174415827 20:50366251-50366273 AAAAATAAGGAAAATTAGACAGG - Intergenic
1174500187 20:50978636-50978658 AAGAAAAAAGAAAAAGAGAGGGG - Intergenic
1174709528 20:52690275-52690297 AAGAAAAAGGAGAAGGGGAAGGG - Intergenic
1174709531 20:52690281-52690303 AAGGAGAAGAAAAAGGAGAAGGG - Intergenic
1174723880 20:52841045-52841067 AAGAATAAGGAAGAGGAGAGGGG - Intergenic
1174818626 20:53708740-53708762 AAAAAGAAAGAAAAGAAGACAGG - Intergenic
1174930917 20:54813771-54813793 AAGAAAAAGGAAAACTAGCCAGG - Intergenic
1174992236 20:55523242-55523264 GAGAACAAGGAAAAGCACAGTGG + Intergenic
1175065311 20:56279619-56279641 AAGAAAAATGAAAAGGAGAGGGG + Intergenic
1175163036 20:57022812-57022834 AAGAGCCAGGAGAGGGAGACAGG - Intergenic
1175675074 20:60939376-60939398 AAGGATAAGGAACTGGAGACGGG + Intergenic
1176221994 20:63974179-63974201 CAAAACAAGGAAGACGAGACAGG + Exonic
1176742603 21:10617620-10617642 AAGAAAGAGGAAAAGAAGAAAGG + Intergenic
1176911870 21:14575770-14575792 AAGCACAAAGAAAATGAGAATGG + Intronic
1177114863 21:17073343-17073365 AAGAAGAAGGGGAAGGAGAAGGG + Intergenic
1177219955 21:18179665-18179687 AAGTACAAGGAAAAGGAGAGTGG - Intronic
1177538420 21:22460080-22460102 AGGAAAAAGGAAAAGGAAGCAGG + Intergenic
1177657622 21:24039660-24039682 TAGAAATAGGAAAAGGAGAATGG - Intergenic
1177933440 21:27314995-27315017 CAGGACATGGAAAAGGAGACAGG - Intergenic
1178349881 21:31865018-31865040 AAGAAGAAGGAGGAGGAGAAGGG - Intergenic
1178424927 21:32471620-32471642 AAAAAAAAGGAAATGGAGGCTGG - Intronic
1178626745 21:34224810-34224832 AAGAAAAAGAAAAGGGAGAGGGG - Intergenic
1178832103 21:36064659-36064681 AAAAAAAAAGAAAAGGAGATGGG - Intronic
1178900465 21:36593938-36593960 AAAGAAAAGGAAAAGAAGACGGG - Intergenic
1178996485 21:37405341-37405363 AAGAATTAGGAAAAGGATGCAGG - Intronic
1179343119 21:40531354-40531376 AAGGACAGGTAAACGGAGACAGG - Intronic
1179395509 21:41036476-41036498 AAGCCCAAGGGGAAGGAGACAGG + Intergenic
1179510322 21:41868674-41868696 AAGAAAAAGAAAAAGGAAAATGG - Intronic
1180525478 22:16255092-16255114 AAGAAAGAGGAAAAGAAGAAAGG + Intergenic
1180571555 22:16726935-16726957 AAGAAAAAGAAAAAGAAAACAGG + Intergenic
1180651998 22:17385450-17385472 AAGCCCAAGGAGAGGGAGACAGG + Intronic
1180685239 22:17661071-17661093 AAGAAAAAAGAAATGGAGCCAGG - Intronic
1181469662 22:23130157-23130179 AAGAAAAAGAAAAAGAAGGCCGG + Intronic
1181600508 22:23949261-23949283 AAAAAAAAGGAAGAGGAGAAAGG - Intergenic
1181608002 22:23992066-23992088 AAAAAAAAGGAAGAGGAGAAAGG + Intergenic
1181831159 22:25561829-25561851 AAGAAAAAGGGAAAGAAGAGGGG + Intergenic
1182031616 22:27163422-27163444 AAGAAAAATGAAAGGGAGAGAGG + Intergenic
1182173820 22:28262111-28262133 AATAACAAAGAGAAGGAGAAGGG + Intronic
1182505053 22:30776090-30776112 AAGAAAAAGAAAAATGAGTCTGG - Intronic
1182708448 22:32305322-32305344 AGGCACAAGGATTAGGAGACAGG - Intergenic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1182860017 22:33551548-33551570 ACAAACAAGAAAAAGGAAACTGG + Intronic
1183091078 22:35522581-35522603 AAGAAGAAAGAAAAAGAGAGAGG - Intergenic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183312607 22:37118967-37118989 GGGAAAAAGGAAAAGGAGAAAGG - Intergenic
1183389003 22:37533135-37533157 AAGAAAAAAGAAAAGAAGGCGGG + Intergenic
1183543055 22:38441023-38441045 AAGGGCATGGAAAAGGAGAGGGG + Intronic
1184089312 22:42283940-42283962 AAGGAGAAGGAAAAGGAAAGGGG + Intronic
1184396151 22:44242855-44242877 AGGCACAAGGATTAGGAGACAGG - Intergenic
1184437545 22:44488760-44488782 AAGGAAAAGGAAAAGGAAAGGGG + Intergenic
1184507412 22:44912909-44912931 AGGAAAAAAGAAAAGGAAACTGG + Intronic
1184676180 22:46044706-46044728 AAGAAGGAGGAAAAGCAGGCCGG - Intergenic
1184811344 22:46834634-46834656 AAGAGCAAGGAAAAGGGGCTGGG + Intronic
1184883682 22:47328828-47328850 GAGAAAAAGGAAAAGGAAAGAGG - Intergenic
1185007872 22:48294870-48294892 CAGAACAAGAAAAATGATACGGG + Intergenic
1185304942 22:50109852-50109874 AAGAGAAAGGAAAAGGAGGCTGG + Intronic
1185352989 22:50347727-50347749 AAGAACAAGACACAGGAGAAGGG - Intronic
1203290032 22_KI270735v1_random:27800-27822 AAGAAAGAGGAAAAGAAGAAAGG - Intergenic
949366270 3:3285001-3285023 AGGAAGAAGGAGAAGGAGAAGGG - Intergenic
949614667 3:5739734-5739756 AGGAACAAGGAAGAGGGGAAAGG - Intergenic
949821145 3:8116544-8116566 AAAAACAAGAAAAAGAAAACAGG - Intergenic
949926992 3:9049307-9049329 AGGACCATGGAAAAGGAGAGAGG - Intronic
950071779 3:10158444-10158466 AAAAAAAAAGAAAAGGAGGCCGG - Intergenic
950120413 3:10478733-10478755 AAGAACTAGGACAAGGACATGGG - Intronic
950224903 3:11225473-11225495 ATGATCAGGGAAGAGGAGACAGG + Intronic
950380165 3:12606529-12606551 AAGAAAAAGAAAAAGCACACAGG - Intronic
950403923 3:12792763-12792785 AAGAAAAAAGAAAAAGAGGCTGG - Intergenic
950647278 3:14384606-14384628 AAGAAAAAGGAAGTGGAGAAAGG - Intergenic
951158837 3:19390380-19390402 AAGAAGAAAGGAAGGGAGACAGG - Intronic
951541279 3:23784212-23784234 AAAAACAAGGAAAAGTTAACCGG - Intergenic
951651900 3:24959786-24959808 AAGAACAAGGGGAATGAGGCAGG + Intergenic
951819857 3:26796145-26796167 AAGTACAAGGTAATGTAGACAGG + Intergenic
952130157 3:30352774-30352796 CAGAAAGAGGAAAATGAGACAGG + Intergenic
952135982 3:30420295-30420317 AAGAAGAAGTAAGAGGAAACTGG + Intergenic
952288260 3:31989104-31989126 AAGAGGAAAGAAAAGGAGCCAGG + Exonic
952303047 3:32121245-32121267 GAAAAGAAGGAAGAGGAGACAGG - Intronic
952354967 3:32575517-32575539 ATGAGTAAAGAAAAGGAGACTGG - Intergenic
952537572 3:34328153-34328175 AAGAACAAGAACAAGGACAAGGG - Intergenic
952699384 3:36310004-36310026 AAGAAGAAGAAAATGGATACTGG + Intergenic
952985870 3:38782458-38782480 AAGAACAAAGAGAAAGAGAATGG - Intronic
953231082 3:41065577-41065599 GAGAACAAGGAAAACAAGATGGG - Intergenic
953423380 3:42772513-42772535 AAGAAGAAAGAGAAGGAGAGGGG - Intronic
953673472 3:44981892-44981914 AAGAAAAAGAAAAAAGAGAAGGG + Intronic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954382954 3:50229314-50229336 AAGGACAAAGAAAAGGAGGGAGG + Intronic
954620373 3:51992020-51992042 AAAAAAAAGGAAAAAGAAACAGG + Intergenic
954726219 3:52613245-52613267 AAGAAGAAGAAAAAGGGGATAGG + Intronic
955079156 3:55641716-55641738 CAGTAGAAGGAAAAGGAGAGAGG - Intronic
955275190 3:57540495-57540517 AAGAACAAGGATAAGTATTCAGG + Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955307465 3:57848608-57848630 AAGAAGAAGAAAAAGAAGAGGGG - Intronic
956058224 3:65323000-65323022 TAGAAAAAGAAAAAGGAGGCCGG - Intergenic
956274634 3:67484740-67484762 ATGAAAAAGAAAAAGGAGATAGG + Intronic
956279951 3:67545744-67545766 AGGAAGAATGAAAAGGAGAGAGG - Intronic
956530409 3:70211724-70211746 AAGAAAAAGGAAAAAGAGAAAGG - Intergenic
956627493 3:71281066-71281088 AAGAAGAAGAAAAAGTAGCCAGG + Intronic
956642244 3:71426199-71426221 AAGAATCAGGCAAAGGAGTCAGG + Intronic
956847354 3:73195758-73195780 AAGAAAAAAGAAAAAGAAACAGG - Intergenic
957047332 3:75386151-75386173 AAGAATAAAGAAAGAGAGACAGG + Intergenic
957106637 3:75897532-75897554 AAGAAAAAGAAAAAGAAAACAGG - Intergenic
957138252 3:76317217-76317239 AAGTACATGGAAAAATAGACTGG + Intronic
957199001 3:77107926-77107948 AAGAAGAAAGAAAATGAGGCAGG - Intronic
957280104 3:78139806-78139828 AAGAAAAAGGAAAAGAAAAGTGG + Intergenic
957885005 3:86275488-86275510 AAGAACTAAGAAAAGGAGGCAGG - Intergenic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
958635924 3:96746681-96746703 AAGAATAAGGAAGAGGAAAGAGG + Intergenic
958885439 3:99721393-99721415 AGGAAAAAGGAAAAGGGGAAAGG + Intronic
958996292 3:100909140-100909162 AAAAACAAGCAAATGGAGAAAGG + Intronic
959174158 3:102884264-102884286 AAGAAAAAGGAAAAGAAGAAAGG - Intergenic
959359743 3:105373614-105373636 AAGTACAGGGAAAAGGAAAAGGG - Intronic
959369253 3:105503458-105503480 AGGCACAGTGAAAAGGAGACAGG - Intronic
959610417 3:108288005-108288027 AAGAAAAAAGAAAAAGAGCCAGG - Intergenic
959722272 3:109505440-109505462 AAGAAAAAAAAAAAGGAGAAGGG - Intergenic
959937123 3:112040752-112040774 CAGTACAAGCAAAGGGAGACTGG + Intronic
959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
960090492 3:113633577-113633599 AACAAGAAGGTAAATGAGACTGG + Intergenic
960247044 3:115411383-115411405 AAGAACCAGGGAAGGAAGACAGG + Intergenic
960470656 3:118061175-118061197 AACAAAAAGGAAGAGGAGAAAGG - Intergenic
960540064 3:118851904-118851926 CAGAAAAAGGAAAAGGGGAGGGG + Intergenic
960540524 3:118856765-118856787 AGGCCCAAGGAAAAGGAGAGAGG - Intergenic
960583418 3:119299536-119299558 AAGAACAAGGATAAGGCAACGGG + Intronic
960591556 3:119371302-119371324 AATAACAGGGAACAGGAGAGGGG - Intronic
960690203 3:120338916-120338938 TAGAAGGAGGAAAAGCAGACTGG + Intronic
960798354 3:121512506-121512528 AAGAAAAAGGAAAAGGTATCTGG - Intronic
961112349 3:124295835-124295857 GACAAGAAGGAAAAGAAGACAGG - Intronic
961320482 3:126069948-126069970 AAGAATAAAGAAAAAGAAACAGG + Intronic
961429262 3:126869280-126869302 AAAAAAAAAAAAAAGGAGACTGG - Intronic
961662047 3:128474123-128474145 AGGAACAAGGCAGAGAAGACAGG + Intergenic
961725133 3:128923192-128923214 ACGACCATGGAACAGGAGACTGG + Intronic
961849268 3:129798538-129798560 AAAAAAAAAGGAAAGGAGACAGG + Intronic
961866655 3:129958360-129958382 AAGAAAGAGGGAGAGGAGACTGG + Intergenic
962005796 3:131348417-131348439 AAGAACTATGAGAAGGAGCCTGG + Intronic
962040318 3:131700590-131700612 AAGAAAGAGGAAAAAGAGAATGG - Intronic
962579587 3:136785736-136785758 AAGAAAAAAGAAATTGAGACAGG - Intergenic
962935713 3:140078682-140078704 AAGAACAAAGAAAAGGAAAACGG + Intronic
962952186 3:140229486-140229508 GAGAAAAAGGAAAAGGAGGGTGG - Intronic
963068638 3:141283589-141283611 AAAAACAAAGAAAAGTACACTGG + Intronic
963349285 3:144132987-144133009 ATGAACAAAGAAAAGGAGGCTGG - Intergenic
963559906 3:146851307-146851329 AAGATGAAGGAAAAGGAGAAAGG + Intergenic
963931462 3:151008340-151008362 AAGAACAAAGTCAAGGAGGCAGG - Intergenic
963936889 3:151062935-151062957 AACAACAAAGAAGAGGAGAATGG + Intergenic
964103192 3:153011206-153011228 AAGAACAAAGAAAGGGAGGGAGG + Intergenic
964236002 3:154528592-154528614 AAGAAAAAGGAAAAGGAGGAAGG - Intergenic
964404723 3:156337447-156337469 AAGAAGAAGGAAAATGAAAAGGG - Intronic
964526933 3:157625035-157625057 AAGAGAAAGGCAAAGGAGATTGG + Intronic
964570838 3:158106070-158106092 AAGAAGAAGGAAAAAAAGAGCGG - Exonic
964878403 3:161395789-161395811 GAAAACAAGGAGAAGGAGCCAGG + Intergenic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
965124449 3:164607511-164607533 AAGAAACAGGCAAAGAAGACAGG - Intergenic
965128277 3:164658653-164658675 AAGAACAGGGGAAAGGGGAGAGG + Intergenic
965364349 3:167779897-167779919 AAGAAAGAGAAAAAGGAGAAAGG + Intronic
965380450 3:167981678-167981700 AAGAAGAAGAAGAGGGAGACAGG - Intergenic
965549883 3:169953374-169953396 AACAACAAAAAAAAGGAGATGGG + Intergenic
965888099 3:173474129-173474151 AAGGAAAAGGAAAAGGAGGAGGG - Intronic
965906455 3:173713221-173713243 AAGAATAAAGAAAAGGAGTTAGG + Intronic
966153931 3:176895677-176895699 TAAGACAAGCAAAAGGAGACTGG + Intergenic
966428064 3:179802236-179802258 AAGAAAAAAGAAAAGCAGGCTGG + Intronic
966565206 3:181372106-181372128 AAGAAAAAGCAAAATGAGAAGGG + Intergenic
966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
966926777 3:184649465-184649487 AAGAAAAAGAAAAAAGAAACAGG + Intronic
966954738 3:184864120-184864142 AAGAGGAAGGAGAAGGAGAAGGG + Intronic
967213070 3:187185898-187185920 AAGAACAAAGAAATGGAGGTGGG + Intergenic
967313699 3:188130716-188130738 AAGAAGGAGGAGAAGGAGAAGGG + Intergenic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
967365483 3:188681660-188681682 AAGGAGAAGGAAAAGGAGGGAGG + Intronic
967390724 3:188951460-188951482 AAGAAGAAGAACATGGAGACTGG + Intronic
967655010 3:192037034-192037056 ATGAACTAGGAAAGGTAGACCGG - Intergenic
967932690 3:194701945-194701967 AAGAAGAAGAAAAAGAAGAAAGG - Intergenic
967974407 3:195024895-195024917 AAGAACATGGAAAACAAGGCCGG - Intergenic
968012899 3:195298555-195298577 ATGATTAAGGAAAAGGAGAGAGG - Intronic
968061922 3:195732316-195732338 AAGAAAAAGAAAAAGAAAACTGG - Intronic
968492270 4:896316-896338 AAGGAAAAAGAAAAGGGGACGGG + Intronic
968527049 4:1065463-1065485 AAGAAAAAAGAAAACGAGAGAGG - Intronic
968893459 4:3385055-3385077 GGGACCAAGGAAAAGGAGCCAGG - Intronic
969129271 4:4979573-4979595 GGGAACAAGGCAAATGAGACAGG - Intergenic
969202006 4:5613980-5614002 AAAAGCTAGAAAAAGGAGACAGG + Intronic
969727482 4:8930395-8930417 AGGAACCAGGAAAAGGAACCAGG + Intergenic
969759490 4:9171781-9171803 AAAAAGATGGAAAAGAAGACAGG + Intronic
970027992 4:11644360-11644382 AAGAAGGAGAAAAAGGAGAGGGG - Intergenic
970056932 4:11984516-11984538 TAGAACAAGGACAAGGACAAGGG + Intergenic
970166840 4:13247537-13247559 GAGAAAAAGGGAAAGGAGAATGG - Intergenic
970636726 4:18019349-18019371 AATAACAAAGAATATGAGACAGG + Intronic
970661572 4:18291566-18291588 GAGAAGAAGGAAAAGCAGCCAGG + Intergenic
970868386 4:20784567-20784589 AAGAAGAAGGAAAGGGAAAGAGG - Intronic
971166778 4:24191667-24191689 AAAAAGAAGGAAAAGGAGAAAGG + Intergenic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971317893 4:25582608-25582630 ATGAAGAAGGAAAAGAAGACGGG - Intergenic
971335787 4:25722933-25722955 GAGAAAAAGGAATAGGAGAAGGG + Intergenic
971584256 4:28384875-28384897 AAGAACTAGGAAATGTAGCCAGG - Intronic
972132029 4:35849688-35849710 AGGAACAAGGAAATGAAGACAGG + Intergenic
972153679 4:36129320-36129342 AGGAACAGGGAAAAGAAGCCTGG - Intronic
972451405 4:39203088-39203110 AAGAAAAAGAAAAAGGAAAAAGG - Intronic
972776152 4:42242711-42242733 AAAAAGAAGGAAAAAGAAACAGG + Intergenic
973008063 4:45037949-45037971 GAGAATAAGGAAAAAGAGATGGG - Intergenic
973120460 4:46515502-46515524 AAGAGGAAGGAAAAGCAGACTGG - Intergenic
973276623 4:48317124-48317146 AACAAAAAGGAAAAGGGGAAAGG - Intergenic
973955053 4:56055237-56055259 AAGAAGGAAGATAAGGAGACAGG + Intergenic
973998699 4:56487374-56487396 AAGGGCAAGGAAGAGAAGACAGG - Intronic
974032057 4:56784859-56784881 AAAAAAAAAGAAGAGGAGACAGG + Intergenic
974336289 4:60549652-60549674 AAGAACAAGGAAACAAAGTCAGG - Intergenic
974736343 4:65938431-65938453 AAGAAAAAGTAAAAAGAGACAGG + Intergenic
974831786 4:67198591-67198613 AAGAGGAAGGAAATGTAGACTGG - Intergenic
974903445 4:68030296-68030318 AAGAGAAAGGAAAAGTAGAGTGG - Intergenic
975198802 4:71560207-71560229 AAGAAAAAGAAAAAGAAGAAGGG + Exonic
975687227 4:76929160-76929182 AAGAAGAAAGAAAAGGGGAAAGG + Intergenic
975857874 4:78643584-78643606 AATAACAAGGGAAGGGAGAGAGG + Intergenic
976103629 4:81593047-81593069 AAGAACAAGCAGAAGGAGCAGGG + Intronic
976647765 4:87403007-87403029 ATGACCATGGAACAGGAGACTGG - Intergenic
976671103 4:87654612-87654634 AAGAACAGGCAATAGGAGAAAGG + Intronic
977795317 4:101157573-101157595 TAGTACAAGGAAAATGAGACTGG + Intronic
978019883 4:103794542-103794564 AAGAACAAGAAAAAAGACAAGGG - Intergenic
978183410 4:105829973-105829995 AAGAAAAAGAAAAATGAAACTGG + Intronic
978599796 4:110415922-110415944 AAGAGCAAAGAAAAGGAGCCAGG + Intronic
978644985 4:110919369-110919391 ATGAAACTGGAAAAGGAGACAGG - Intergenic
978946155 4:114499749-114499771 AAGAACAAACAAAAGAACACTGG - Intergenic
978978782 4:114915818-114915840 AAGAAGGAGGAGAAGGAGAGGGG + Intronic
979291864 4:118987050-118987072 AAGAACAATGATAAGGATAATGG - Intronic
979484667 4:121257022-121257044 AAAAACAAGAAAATGGATACAGG + Intergenic
979521666 4:121674328-121674350 AAGAAAAGGAAAAAGGAGAAAGG + Intronic
979646228 4:123073214-123073236 AAGAAGAAAGAAAAGGAGATAGG - Intronic
980553975 4:134378731-134378753 AAGAAAAAGAAAAAGGTGTCTGG + Intergenic
980578048 4:134711201-134711223 AAGAACTAGGAAAAGAAGGCAGG + Intergenic
980603332 4:135055564-135055586 AAGAAAAAGAAAAAGAAGAAAGG - Intergenic
980652139 4:135731770-135731792 AGGAAAAAGCAAAAGGAGCCTGG - Intergenic
981039191 4:140206992-140207014 AAAAAGAGGGAAAAGGAGAAAGG + Intergenic
981269345 4:142826450-142826472 AAGAGAATGGAAAAGGGGACAGG - Intronic
981365879 4:143902596-143902618 AGGAAGAAGGAAAAGGAAAAAGG - Intronic
981391059 4:144192457-144192479 CAGAACATGATAAAGGAGACTGG - Intergenic
981766000 4:148250922-148250944 AAGAAAAAGGTGATGGAGACTGG - Intronic
981936695 4:150247060-150247082 AAGAAGAAGGGAAAGGAGATCGG + Intronic
981950707 4:150403549-150403571 AAGGAGAAGGGAAAGGAGAAGGG - Intronic
982352184 4:154428124-154428146 TAGAAAAAGGAAAGGCAGACTGG + Intronic
982439717 4:155421640-155421662 AGGAGCATGGCAAAGGAGACAGG - Intergenic
982452497 4:155569927-155569949 AAGAAAAAGAAAAAGGGGAAGGG + Intergenic
982993015 4:162303162-162303184 AAGAACCAGAGAAAGGAGCCTGG - Intergenic
983019134 4:162653529-162653551 AAGAAAAAGGACAAGGAGGTTGG - Intergenic
983317532 4:166151153-166151175 AAGAAAGAGGAAGAGGAGAGTGG + Intergenic
983319925 4:166183752-166183774 AAAAACAAGGAAAAGAACAGAGG - Intergenic
983337873 4:166419920-166419942 AAAAAAAAGGAAAAGAAAACAGG - Intergenic
983500930 4:168499210-168499232 AGGAAGAAAGAAAGGGAGACGGG + Intronic
984271744 4:177556819-177556841 AAGAAAAAGAAAAAAGAAACTGG - Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984725162 4:183013450-183013472 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
984725165 4:183013456-183013478 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
984850123 4:184145304-184145326 AGGAAGAAAGAAAAGGAGGCAGG - Intronic
984908780 4:184652849-184652871 AAGAAAAAAGAAAAGGAGGGAGG + Intronic
985016106 4:185637604-185637626 AAGAAGAAGAAAATGGGGACTGG - Intronic
985113005 4:186565158-186565180 AAGAAAAAAAAAAAGTAGACCGG - Intergenic
985690137 5:1304322-1304344 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
986140542 5:5025963-5025985 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
986248050 5:6029019-6029041 AACAAAAAGCAAAAGGAGGCTGG - Intergenic
986278658 5:6304545-6304567 GAGGAAAAGAAAAAGGAGACGGG + Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
986731944 5:10641205-10641227 AAGAAGAAGAAGAAGAAGACTGG - Intronic
987120137 5:14759769-14759791 AAGAAAAAAGAAGAGGAGAGGGG + Intronic
987182750 5:15384954-15384976 AAGGGCAAGGAAGAGGAGAAGGG - Intergenic
987493497 5:18613122-18613144 AAAAAAAAGGGAAAGGAAACAGG - Intergenic
987503954 5:18746306-18746328 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
987552504 5:19402322-19402344 GAGAAAAATGAAAAGGATACTGG + Intergenic
987737393 5:21864915-21864937 AAGAACAAGGTATTGGAAACTGG + Intronic
987811419 5:22840960-22840982 AAGAACAAGGGGAAGGATGCAGG + Intronic
987956530 5:24748461-24748483 ATGACCACGGAACAGGAGACTGG - Intergenic
988413637 5:30917946-30917968 AAGAAGAACAGAAAGGAGACAGG - Intergenic
988456902 5:31394758-31394780 ACGACCATGGAACAGGAGACTGG - Intergenic
988632077 5:32942324-32942346 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
988725873 5:33926156-33926178 AAGAAAAAAGAAAAAGAAACAGG - Intergenic
988914656 5:35880402-35880424 AAGAACAAGAAAAAGTAGGAAGG - Intergenic
989278068 5:39611336-39611358 AAGAAAAAGAAAAAAGAGAGAGG - Intergenic
989375703 5:40757538-40757560 AAAAACAAGGAAAGGGAAAGGGG + Intergenic
989529275 5:42488082-42488104 AGGCTGAAGGAAAAGGAGACAGG - Intronic
989531588 5:42513872-42513894 AAGAACAAAGAAGGGAAGACAGG - Intronic
989561018 5:42851445-42851467 AAAAAAAAAGAAAAGGAAACAGG - Intronic
989705994 5:44331424-44331446 GAGAAAGAGGAAAAGGAAACTGG + Intronic
989813257 5:45704098-45704120 AAGAACAAAGATAAAGAGAGGGG - Intergenic
990086416 5:51983624-51983646 AAAAAGAAGGAAATGGAGAGAGG - Intergenic
990096768 5:52123996-52124018 AAGCAAAGGGAAAAAGAGACTGG + Intergenic
990134414 5:52628216-52628238 AACAACAATGAAAAGGACAAGGG - Intergenic
990286297 5:54303718-54303740 AAAAAGAAGAAAAAGGAGAGGGG + Intronic
990389904 5:55308086-55308108 AAAGACAAGGAAAAGGACAAGGG + Exonic
990681522 5:58249897-58249919 AGGAAGAAGGAAGAGGAGAAGGG + Intergenic
990739031 5:58893563-58893585 TGGAAAAAGGAAAAAGAGACTGG + Intergenic
990796235 5:59544170-59544192 AGGTACAAGGAAAAGGCAACTGG + Intronic
990930748 5:61088292-61088314 AAGAACACGGCAAAGGTGATGGG - Intronic
990946071 5:61251126-61251148 AAGAAGAAGAAAAAGAAGATAGG + Intergenic
990949995 5:61289307-61289329 AAAAAAAAGGAAAAAAAGACTGG + Intergenic
991076777 5:62548629-62548651 AAGAAGAAAGAAAATAAGACTGG - Intronic
991272138 5:64796764-64796786 AGGAAGAAGGAAAAGGAGGGAGG - Intronic
991272151 5:64796808-64796830 AGGAAGAAGGAAAAGGAGGGAGG - Intronic
991507400 5:67339556-67339578 AAGCAAAAGGAAAAGGAAAAGGG - Intergenic
991511130 5:67377309-67377331 CAGAACTGGGAAAAGGAGAGGGG - Intergenic
991520812 5:67494882-67494904 AAGAAAAAGGAAAAAGAAAAAGG + Intergenic
991669965 5:69037800-69037822 GAGAAAAAGGAAAATGAGGCTGG + Intergenic
991683266 5:69159359-69159381 AAGAAAAAGGAAAAAAAGAAAGG - Intergenic
991939159 5:71833426-71833448 AAGAACCAGAAAAAGAAGAGAGG - Intergenic
992205140 5:74423545-74423567 AAGAAAAGGGAAAGGGAGAGGGG + Intergenic
992440764 5:76795833-76795855 AAGAAAAAGAAAAACCAGACAGG - Intergenic
992556420 5:77907578-77907600 AAAAAGAAAGAAAGGGAGACTGG + Intergenic
992821873 5:80505720-80505742 AGGAAGAAAGAAAAGGGGACTGG - Intronic
993439587 5:87939361-87939383 AAAATCAAGGAAAGGGAGGCAGG - Intergenic
993598723 5:89892470-89892492 AAGAGCAAGGAAAAGGGGCAGGG + Intergenic
993926611 5:93873447-93873469 AAGGAAAAGGAAAAGGGGAAAGG + Intronic
994130839 5:96225893-96225915 AAGAAAAAGGAGAAGAAGAATGG - Intergenic
994350610 5:98742233-98742255 GAGAGCAAGGAAAAGAAGAGTGG + Intergenic
994390512 5:99187033-99187055 AAGAAAAAGGAAAAGAAAACTGG - Intergenic
994679264 5:102865557-102865579 AAGAAGTAGGAAAAGAAAACAGG + Intronic
994733637 5:103524618-103524640 GTGATCAAGGAAAAGGATACAGG + Intergenic
995104209 5:108355031-108355053 AGAAACAAGGAAAATGACACAGG + Intronic
995245918 5:109935643-109935665 AAGAAAAAGGAAAAGATGAGAGG - Intergenic
995423533 5:111993255-111993277 AAGAAAAAGGGAAAAGAGAAAGG + Intronic
995847671 5:116511491-116511513 AAGAAAAAGGAACAGAAGAAAGG + Intronic
995860356 5:116634475-116634497 AAGAAAAAAGAAAAGGAAAAGGG + Intergenic
996452322 5:123639641-123639663 AAGAAGAAGAGAAAGGAGAGAGG - Intergenic
996655992 5:125937185-125937207 AAGACCAAGGACAAGAAAACAGG - Intergenic
996872839 5:128210956-128210978 AAGTATAAAGAAAAGAAGACTGG + Intergenic
997017653 5:129955429-129955451 AAGGAAAAAGGAAAGGAGACGGG - Intronic
997029290 5:130105182-130105204 AAGAAAAAAGAAAGGGAGAAAGG - Intronic
997394326 5:133545923-133545945 AAGAACAAGGTATTGGAAACTGG + Intronic
997763360 5:136472518-136472540 AAGAAGAATCAAAAGGAGATGGG - Intergenic
998051808 5:139042183-139042205 AAGGACAAGGACAAGGATTCCGG + Intronic
998368588 5:141646810-141646832 AAGGACAAGGACAAAGAGAAAGG + Intronic
998781416 5:145660734-145660756 AAGAAATAGGAACAGGAGAAGGG + Intronic
998880299 5:146638437-146638459 AGGAACCAGGAGAAGGAGGCAGG + Intronic
998986118 5:147759245-147759267 AAGAAAAAGAGAAAGGAGAAGGG + Intronic
999015312 5:148097060-148097082 AAGAAAAAGAAAAAGGAGAAAGG - Intronic
999162132 5:149510451-149510473 AAAAACAAAGAAAAGGAAAAAGG - Intronic
999213390 5:149910860-149910882 AAAAAAAAGGAAAAAGAAACTGG - Intronic
999310306 5:150547514-150547536 AAGAACTATAAAAGGGAGACTGG - Intronic
999390517 5:151186348-151186370 AAGAGGAAAGAAAAGAAGACGGG + Intronic
999491341 5:152054446-152054468 TAGCCCAAGGAAAAGCAGACTGG - Intergenic
999706340 5:154275774-154275796 GAGAACAAGGAAAATGTGCCTGG + Intronic
1000074654 5:157773670-157773692 AAAAACAAGAAACAGGAGGCTGG + Intergenic
1000209815 5:159098684-159098706 AAGAAGAAAGAAAAGAAGGCAGG + Intronic
1000564691 5:162833332-162833354 AAGAACTAGGAAAAGGTGTTTGG - Intergenic
1000835904 5:166153854-166153876 TAGAAAAAGGAAAATGAGGCTGG - Intergenic
1000899069 5:166891220-166891242 AATAAAAAGGAAAACGAGGCCGG + Intergenic
1001039955 5:168327254-168327276 AAGAATGAGGGAAAGGAGAGGGG - Intronic
1001617527 5:173055377-173055399 AAGCACAGGGAAAGGAAGACGGG - Intergenic
1001861859 5:175062831-175062853 AAGAAAAAAAAAAAGGAGAGGGG - Intergenic
1001865199 5:175097851-175097873 AGGAACAAGGAGCAGGAGATGGG - Intergenic
1001890973 5:175338239-175338261 AAGAAGAAGAAGAAGGAGACAGG - Intergenic
1002208155 5:177578623-177578645 AAGAAAAAAGAAAAGAAGAAAGG - Intergenic
1002510550 5:179713619-179713641 AAGAAAAAGTAAATGGAGCCAGG + Intronic
1002847780 6:963307-963329 GAGAAGATGGAAAAGGAGAGAGG + Intergenic
1002917064 6:1538048-1538070 AAGACCAAAGAAAAGGAGGGAGG + Intergenic
1003262392 6:4531279-4531301 AAGAGCAAGGAAAAAGAGAAAGG + Intergenic
1003507991 6:6755638-6755660 AAAAAAAAGTAAAAGGAAACAGG - Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003720877 6:8700898-8700920 AGAGACCAGGAAAAGGAGACTGG - Intergenic
1003846932 6:10183390-10183412 AAGAACAAGGAAAAGTAATCAGG + Intronic
1003969987 6:11290147-11290169 AAGAATGAGGAAATGGACACAGG - Intronic
1004251889 6:14029596-14029618 AAAAATAAGGAAAATGAGGCTGG + Intergenic
1004355110 6:14923752-14923774 AAGAATATGGAAGAGGAGAGGGG - Intergenic
1004404979 6:15324478-15324500 AAGAAGAAGAAAAAGGAGGGGGG - Intronic
1004411597 6:15386241-15386263 AAGAACAGGGAGAGGGAGAGGGG - Intronic
1004462717 6:15853434-15853456 AAGAAGAAGGAGAAGCAGAAGGG - Intergenic
1004528386 6:16430292-16430314 AACAACAATGAAAAGAAGGCAGG + Intronic
1004533687 6:16478536-16478558 AAGGAAAAGGCAAAGGAAACCGG + Intronic
1004569932 6:16835237-16835259 AAAAAAAAAGAAAAGGAGGCTGG - Intergenic
1005044447 6:21628717-21628739 AAGGACAAGGGGAAGGAGAGTGG + Intergenic
1005083625 6:21981564-21981586 CAGAACAAGAAAGAGGAGGCAGG - Intergenic
1005609602 6:27510977-27510999 AAAAAAAAGGAAAAGAAGCCTGG + Intergenic
1005950029 6:30625116-30625138 AAGACAAAGAACAAGGAGACAGG - Intronic
1006113823 6:31764576-31764598 AAGAAACAGAAAAAGGAGCCTGG - Exonic
1006179149 6:32143559-32143581 AAGAAAAAAGAAAAAGAGGCTGG + Intergenic
1006250554 6:32779792-32779814 AGGAACAAGGAATTGGAAACTGG - Intergenic
1006461253 6:34160237-34160259 AAAAACCTGGAAAAGGAGAAAGG + Intergenic
1006555168 6:34859601-34859623 CAGAACTAGGAGAAGGAGATGGG - Intronic
1006564452 6:34942954-34942976 AAGGAAAAGGAAAAGGAAAGGGG - Intronic
1007020670 6:38517619-38517641 ATTAACTAGGAACAGGAGACAGG + Intronic
1007427943 6:41759362-41759384 GAGAACAAGGCAAAGGAGCATGG - Intergenic
1007521896 6:42456501-42456523 AAGAAAAAGTAAAAAGAGATAGG - Intergenic
1007731994 6:43953026-43953048 AAGATAAAGGGAAAGGGGACAGG - Intergenic
1007732554 6:43956439-43956461 AAGAACAAGGAAAAATGAACAGG + Intergenic
1008323319 6:50145262-50145284 AAGAAAAAGAAAAAGAAGAAAGG + Intergenic
1008373795 6:50768307-50768329 GAGAAAAAAGAAAAGGAGAGAGG - Intronic
1008495732 6:52132274-52132296 AAGGACAAGGGAAGGGAGAAAGG + Intergenic
1008824364 6:55674836-55674858 AACCAAAAGGAAGAGGAGACAGG + Intergenic
1008887264 6:56444683-56444705 AAAAAAAAGGAAAAGGAAAAAGG + Intergenic
1009305582 6:62085473-62085495 AAAAAAAAGGAAAAGGCAACAGG + Intronic
1009512392 6:64569444-64569466 AAAAAGAATGAAAAGGAGCCGGG + Intronic
1009582132 6:65549803-65549825 AAGGACAAGGATAGGCAGACAGG - Intronic
1010156013 6:72793750-72793772 AAGAAGCAGGAAACGGAGATGGG + Intronic
1010295037 6:74185640-74185662 AAGTAGAAGGAAAAGGAGGCAGG + Intergenic
1010386962 6:75291231-75291253 AATAACAGGGAAAAGGAGACAGG + Intergenic
1010430773 6:75776008-75776030 AAGGACAAGGACCAGGACACAGG - Intronic
1010708766 6:79146872-79146894 ATGAAGATGGAAAAGGAGAGTGG + Intergenic
1011085651 6:83537616-83537638 AAGAACAAGGAAAGGAAGGAAGG - Intergenic
1011175051 6:84551045-84551067 AAGAACCAGGAGACTGAGACTGG - Intergenic
1011428201 6:87253636-87253658 ACTAAAAAGGAAAAGGAGCCTGG - Intronic
1011695539 6:89909426-89909448 AAAAAAAAGGAAAGAGAGACAGG - Intergenic
1011743020 6:90382135-90382157 TAAACCAGGGAAAAGGAGACTGG + Intergenic
1011860211 6:91745922-91745944 AAGAACTAGGCAAAAGAGATGGG - Intergenic
1011951576 6:92973330-92973352 AAGTACTTGAAAAAGGAGACTGG + Intergenic
1012190860 6:96277825-96277847 AAGAAAAAGAAAAAGAATACTGG - Intergenic
1012214456 6:96564783-96564805 AAGAACAAGGAAATGCAAGCTGG - Intronic
1012533193 6:100263551-100263573 AAGAAAAAGGAAAAGAGGAAAGG + Intergenic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1012912272 6:105131938-105131960 AATGACAAGGAAAAAGAGGCTGG - Intronic
1013093406 6:106921605-106921627 AAGAAGAAGGAAAAGGAAAAGGG + Intergenic
1013304685 6:108837511-108837533 GAGAAACAGAAAAAGGAGACAGG + Intergenic
1013495725 6:110695154-110695176 AAGAAGAAAGGAAAGGAGAAAGG + Intronic
1013532485 6:111032812-111032834 AAGAACAAAGAAAAGGCCAGAGG + Intergenic
1013572715 6:111445805-111445827 CAGACATAGGAAAAGGAGACTGG + Intronic
1013855141 6:114563409-114563431 TAGAAAAAGGAAAAGAAGATTGG - Intergenic
1014294198 6:119598401-119598423 AGGCACAAGGAGAAGGAGAAGGG + Intergenic
1014494349 6:122102147-122102169 AAGAAAAAGGAAAAGAAAAGTGG + Intergenic
1014740236 6:125140719-125140741 GAGAAAAAGGAGAGGGAGACAGG + Intronic
1014758805 6:125331841-125331863 AAGAAGAAAGAAAAGGAGGAGGG - Intergenic
1014904706 6:127012023-127012045 AAGAAAAAGGGAAATGAGGCAGG - Intergenic
1015048036 6:128802487-128802509 AAGAACCAGGAAAATATGACTGG - Intergenic
1015278941 6:131411684-131411706 AAGAAGGAGAAAAATGAGACTGG + Intergenic
1015381016 6:132569232-132569254 AAGAATAATGAACAGGAAACTGG - Intergenic
1015434971 6:133174743-133174765 AAGAAGAAGACAAAGGAGAAGGG - Intergenic
1015484638 6:133754902-133754924 AAGAACTAAGGATAGGAGACAGG - Intergenic
1016003561 6:139066941-139066963 AAGGAAAAGGAAAAGGAAAAAGG - Intergenic
1016048724 6:139507156-139507178 ATGAAAAAGAAAAAGGAGAATGG - Intergenic
1016050972 6:139529831-139529853 AAGAACCAGTAGAAGGAGATTGG + Intergenic
1016389235 6:143558598-143558620 AAGAAAATGACAAAGGAGACAGG - Intronic
1016594420 6:145783404-145783426 AAGAACAAGGTATTGGAAACAGG - Intergenic
1016913113 6:149218444-149218466 AAGAACAAGCAAAAGAAGAGTGG + Intergenic
1016944397 6:149515156-149515178 AAGAAAAAAAAAATGGAGACCGG + Intronic
1016945599 6:149529801-149529823 AAGAAAAAGGGAAAGGAGAAAGG + Intronic
1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG + Intergenic
1017128736 6:151090292-151090314 CAGCACAGGGAAAGGGAGACTGG - Intronic
1017199891 6:151741195-151741217 AAAAAGCAGGAAGAGGAGACAGG - Intronic
1017301103 6:152859052-152859074 GAAAACGAGGAAGAGGAGACTGG - Intergenic
1017339571 6:153305207-153305229 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339585 6:153305255-153305277 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1017339626 6:153305405-153305427 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017477829 6:154816228-154816250 AAGAAAAAGGCAAAAGAAACTGG - Intronic
1017479678 6:154839607-154839629 AAGAAAAAGAAAAAGAAGAAAGG - Intronic
1018181773 6:161229535-161229557 TAGAGCAAGGAAAAGGAACCAGG + Intronic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1018349285 6:162939613-162939635 GAGAACAAAGAATAGGAGAAAGG - Intronic
1018463639 6:164022573-164022595 AAGAAGGAGGAAGAGGAGAATGG + Intergenic
1019018200 6:168895990-168896012 AGGAAGCAGGAAAAAGAGACAGG - Intergenic
1019465901 7:1188775-1188797 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1019705484 7:2495420-2495442 AAAAAAAAAGAAAAGGAGAGAGG + Intergenic
1019963783 7:4482914-4482936 AAAAAAAAGGAAATAGAGACAGG - Intergenic
1020140534 7:5609142-5609164 AAAAAAAAGGAAAAAGAGGCCGG + Intergenic
1020395877 7:7717024-7717046 AAGAAAAAGGAAAAAGAAAGAGG - Intronic
1020423229 7:8034723-8034745 AAAAAGAAGGAAAAAGAGGCTGG + Intronic
1020561658 7:9735796-9735818 AAGGAAAAGGAAAGGGAGAGAGG - Intergenic
1021138033 7:16990088-16990110 AAGAACCAGGGAAAGAAGTCTGG - Intergenic
1021289378 7:18823983-18824005 AAGAAGAAGAAGAAGGAGAAGGG + Intronic
1021289380 7:18823989-18824011 AAGAAGAAGGAGAAGGGGAATGG + Intronic
1021617475 7:22517713-22517735 AAGAACAAGGAATAGCTGGCTGG - Intronic
1021620585 7:22547734-22547756 AAGTGCAAGGCAAAGGAGAGTGG - Intronic
1021645787 7:22788285-22788307 CAGAACAAGCAAAAAGAGCCAGG + Intergenic
1021934540 7:25616738-25616760 CACAAGAAGGAAAAGGAGAAAGG + Intergenic
1022099916 7:27163351-27163373 AAGAAAAAGGAAAAGTTGAGGGG - Exonic
1022224938 7:28353463-28353485 AAGAACAAGGAAGACTAGCCGGG + Intronic
1022436417 7:30390124-30390146 TAGAACAAGGTAAAGGAAACAGG - Intronic
1022526160 7:31038673-31038695 AAGAACAAGTAAAGGGAGCTGGG - Intergenic
1022640581 7:32178683-32178705 AGGAACAAGTCAAAGGAGAGAGG - Intronic
1022806685 7:33829572-33829594 AGGAAAAAGGAGAAGGAAACAGG - Intergenic
1022927061 7:35067127-35067149 AAGAACAAGGAATAGCTGGCTGG - Intergenic
1023095309 7:36654308-36654330 AAGAAGAAGAAAAAGGAGAGAGG - Intronic
1023187543 7:37547871-37547893 AAAAAAAAGGAAGAGGAGGCAGG + Intergenic
1023426100 7:40038099-40038121 GAGAACAAGAAAAAGAAGAATGG - Intronic
1023453727 7:40315550-40315572 AAGAATAAAGTAAAGGAGAATGG + Intronic
1023478425 7:40606165-40606187 AAGAAGAAGGACAAAGAGAGTGG + Intronic
1024033375 7:45484112-45484134 AGGAAAGAGGAAAAGGAGGCAGG + Intergenic
1024215675 7:47246256-47246278 AAGTACAGGGAAGAGGAGGCAGG + Intergenic
1024311004 7:47969074-47969096 AAGAACAAAGGAATTGAGACTGG - Intronic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1024525813 7:50348320-50348342 AGGAAGAAGGAGAAGGAGAGGGG + Intronic
1024557303 7:50614559-50614581 AAGCTCAAGGACAAGCAGACAGG - Intronic
1024758250 7:52562514-52562536 AAGAAGATTGAAAAAGAGACAGG + Intergenic
1024919304 7:54541706-54541728 AAGATGAAGGAAAAGAAGGCAGG + Intergenic
1025307714 7:57879131-57879153 AAGAAAGAGGAAAAGAAGAAAGG - Intergenic
1026137607 7:67677297-67677319 TAGGACAAAGAAAAGGAGACTGG + Intergenic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1026231704 7:68489573-68489595 AAGAAAGAGGAAAGGAAGACTGG + Intergenic
1026287166 7:68973464-68973486 AAAAACAAGAAAAAGGAGCCAGG - Intergenic
1026511424 7:71030375-71030397 AAAAACGTGAAAAAGGAGACGGG + Intergenic
1026524473 7:71142350-71142372 AGGAAGAAGGAAATGGAGTCTGG - Intronic
1027146170 7:75696344-75696366 AAGGACAAAGAAAATGAGAGAGG - Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028127521 7:87130813-87130835 AAGATGAAAGAAAAGGAGATCGG + Intergenic
1028261366 7:88670328-88670350 AGGAAGAAGGAAAAGGAGCCTGG - Intergenic
1028375202 7:90138397-90138419 AAGAACAAGGAATAGCTGGCTGG + Intergenic
1028547285 7:92017198-92017220 GAGAACATGAAAAAGGAGATTGG + Intronic
1028877425 7:95839325-95839347 AAGAAAAAGAGAAAGGAGGCTGG - Intronic
1028965216 7:96794534-96794556 AAGAGCTAAGAAAAGGAGAAGGG - Intergenic
1029065430 7:97843559-97843581 AAGACAAAGGAAAAGCAGGCAGG + Intergenic
1029180759 7:98700053-98700075 AAGAAAAAGAAAAAGGAGGGAGG + Intergenic
1029837082 7:103323597-103323619 AAGAAAAAGAAAAAGCAGAATGG - Exonic
1029996160 7:105010528-105010550 AAAAACAAGGAAAAGGAGGTTGG + Intergenic
1030273352 7:107693525-107693547 AACAAAGAAGAAAAGGAGACAGG - Intronic
1030335176 7:108317944-108317966 AAGGAAAAGGAAAAGGAAAGGGG + Intronic
1030383149 7:108836189-108836211 AAGAACAAAGCAAAAGAGGCCGG - Intergenic
1030645670 7:112058741-112058763 AAGAAAAAGGAAAAAGAATCTGG + Intronic
1030692279 7:112547605-112547627 GAGAACGAGGAAAAGCAGAGTGG - Intergenic
1030699136 7:112619643-112619665 AAGAGAAAGAGAAAGGAGACAGG - Intergenic
1030925917 7:115454400-115454422 AAGAACAAGGAAAGGGAGCCAGG + Intergenic
1031209044 7:118798578-118798600 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1031526340 7:122825566-122825588 AAGAACAAGGTAAAGGAAACAGG + Intronic
1031949362 7:127876117-127876139 AAGGACAAAGAGAAGGAGAGGGG - Intronic
1032018516 7:128394097-128394119 AAGGACAAGGAACAGGGGGCTGG + Intronic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032639762 7:133752865-133752887 AAGAACTGGGAAACTGAGACTGG - Intronic
1032662326 7:133998594-133998616 AAGAATAAGGCACAGGAGACAGG + Intronic
1032947674 7:136870899-136870921 AACAAAAAAGAAAAGAAGACAGG - Intronic
1033235044 7:139631419-139631441 AAGAAAAAGGGAAAAGAGAAAGG + Intronic
1033490315 7:141837160-141837182 CAGAACAAGGAAAAAGCCACAGG - Exonic
1033649457 7:143329760-143329782 AAAAACGAGGAAAAGGAACCAGG - Intronic
1033714165 7:143982157-143982179 CAGAACAAGGATCAGGAGTCAGG - Intergenic
1033804342 7:144937470-144937492 AAGGAGAAGGGAAAGGAGAAAGG - Intergenic
1034123618 7:148651210-148651232 AAGAAAAAGAAAAAGGAACCAGG + Intergenic
1034354421 7:150441866-150441888 AAGCAGAAGGAGAAGGAGAAGGG - Intergenic
1035310129 7:157962375-157962397 AACACCAAGGAACAGGAAACGGG - Intronic
1035381642 7:158444716-158444738 GAGGACGAGGAAAGGGAGACAGG - Intronic
1035672554 8:1431493-1431515 AAGAAGAAGAGAAAGGAGAAAGG + Intergenic
1035831210 8:2696682-2696704 AAAAACAAGGGAAAGAAGAGAGG + Intergenic
1036263065 8:7255498-7255520 AAAAAGATGGAAAAGAAGACAGG + Intergenic
1036264369 8:7263121-7263143 AAAAAGATGGAAAAGAAGACAGG + Intergenic
1036265664 8:7270743-7270765 AAAAAGATGGAAAAGAAGACAGG + Intergenic
1036268272 8:7285987-7286009 AAAAAGATGGAAAAGAAGACAGG + Intergenic
1036269576 8:7293609-7293631 AAAAAGATGGAAAAGAAGACAGG + Intergenic
1036298317 8:7553446-7553468 AAAAAGATGGAAAAGAAGACGGG - Intergenic
1036299622 8:7561096-7561118 AAAAAGATGGAAAAGAAGACGGG - Intergenic
1036300926 8:7568742-7568764 AAAAAGATGGAAAAGAAGACGGG - Intergenic
1036302234 8:7576392-7576414 AAAAAGATGGAAAAGAAGACAGG - Intergenic
1036303525 8:7584036-7584058 AAAAAGATGGAAAAGAAGACAGG - Intergenic
1036315104 8:7714038-7714060 AAAAAGATGGAAAAGAAGACAGG + Intergenic
1036324256 8:7767572-7767594 AAAAAGATGGAAAAGAAGACAGG + Intergenic
1036335815 8:7869032-7869054 AAGAAGGAGGAAAAGGAGGGAGG + Intergenic
1036351784 8:8016735-8016757 AAAAAGATGGAAAAGAAGACAGG - Intergenic
1036353085 8:8024381-8024403 AAAAAGATGGAAAAGAAGACAGG - Intergenic
1036354378 8:8032028-8032050 AAAAAGATGGAAAAGAAGACAGG - Intergenic
1036415565 8:8544539-8544561 AAGAACAAAGAAAAAGGGAAGGG + Intergenic
1036556760 8:9866880-9866902 AAAAAAAAAAAAAAGGAGACAGG - Intergenic
1037024940 8:14023725-14023747 AAAAACTAGGAGAAGGAGCCAGG + Intergenic
1037591741 8:20318120-20318142 AAAAAAAAGGAAAAGGCAACAGG - Intergenic
1037800460 8:22031833-22031855 AAGAAAAAAGAAATGAAGACAGG - Intronic
1038526223 8:28275960-28275982 CAGAACAGGAAAAAGGAGCCTGG - Intergenic
1038530614 8:28315538-28315560 AAGAACAGGGAAATGGGGATTGG + Intergenic
1038559324 8:28557584-28557606 AAGAAAAAGGAAATGGATAAAGG - Intronic
1038575360 8:28700244-28700266 AAGAAAAGTGAATAGGAGACGGG + Intronic
1038971301 8:32638821-32638843 AAGCAGCAGGAAAAGGAGATTGG + Intronic
1038994446 8:32905990-32906012 AAGATCAAGGAAAAAGGAACTGG - Intergenic
1039093800 8:33861094-33861116 AGGAAGAAGGAAAGGGAGAATGG - Intergenic
1039160941 8:34618944-34618966 AAGAAAGAGGAAAAGGAAAAGGG + Intergenic
1039262585 8:35787987-35788009 AAGAAAAAAGAAAAGGAGGAAGG + Intronic
1039782561 8:40799778-40799800 TAAAACAAGGTAAAGGAGAAAGG + Intronic
1040365274 8:46709008-46709030 AAGACAAAGGAAAAGCAGGCAGG - Intergenic
1040506815 8:48056561-48056583 CAAAAAAAGGAAAAGGAGACAGG + Intronic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1040719423 8:50299299-50299321 AAGAAGGAGAAAGAGGAGACAGG - Intronic
1040820806 8:51554728-51554750 AGGAACAAGGTAATGGAAACTGG - Intronic
1040919719 8:52602687-52602709 AAGAAAAAGAAAAAGAAAACAGG + Intergenic
1041662283 8:60412147-60412169 AAAAACGAGGAAAAGTCGACAGG + Intergenic
1042106603 8:65333938-65333960 AAGAAGGAGGAAAAGGAGAGTGG + Intergenic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042337379 8:67642511-67642533 AAGAACAAAGAATAAGAAACAGG + Intronic
1042426053 8:68650282-68650304 AAGCAAAAGGAAGAGGAGAGAGG + Intronic
1042839226 8:73107205-73107227 AAAGAAAAAGAAAAGGAGACAGG + Intronic
1042889331 8:73589949-73589971 GAAGACAAGGAAAAGGAGAAGGG + Intronic
1043011307 8:74884960-74884982 AAGAACAAAGAAAAAGAAAAGGG - Intergenic
1043276549 8:78403403-78403425 AAGAAAAAGGAAAAACAGAAGGG + Intergenic
1043385585 8:79744628-79744650 AAGGAGAAGTAAAAGGAGAAGGG + Intergenic
1043560011 8:81481814-81481836 AAAATCAAGCAAATGGAGACTGG - Intronic
1043570929 8:81601596-81601618 AAGAAAAAAGAAAAGGAAAGTGG + Intergenic
1043803815 8:84645509-84645531 GAAAACATGGAAAAGGAGAAAGG - Intronic
1044642301 8:94396073-94396095 AAGAAGAAGGAAAAAGAGTAAGG + Intronic
1044688030 8:94846568-94846590 AAGAATAAGTAAAAAGAGGCTGG - Intronic
1044735363 8:95273188-95273210 ATTAACATGGTAAAGGAGACCGG + Intergenic
1044830120 8:96239009-96239031 AAGAATAAGGAAAAGGAAAGTGG - Intergenic
1044864040 8:96551881-96551903 AGGAAGAAGGAAGAGGAGATTGG - Intronic
1044899250 8:96926522-96926544 AAGAAGAAGAAAAAGAAGAAAGG - Intronic
1045106063 8:98893803-98893825 AAGAACAAGGCAGAGTGGACTGG + Intronic
1045399712 8:101801046-101801068 AGGAAAAAGGAAAAGGAAAAGGG + Intronic
1045415559 8:101963318-101963340 AAAAACCAGGAAAAGGAGATTGG - Intronic
1045426481 8:102071293-102071315 AATACCAAGAAAAAGGATACTGG - Intronic
1045743448 8:105388317-105388339 GAGAAAAGGGAAAAGGAGATGGG + Intronic
1045913159 8:107434303-107434325 ATGAAACAGGAAAAGGAGTCTGG + Intronic
1045974738 8:108119400-108119422 AAGAAGAAAGAAAGGGAGAGAGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046551667 8:115725349-115725371 AAGAACAAGACATAGTAGACAGG + Intronic
1047171598 8:122498427-122498449 AAGAACAAGCAAAGGTAGATAGG + Intergenic
1047455617 8:125007455-125007477 CAGTACAAGGATAAAGAGACTGG + Exonic
1047523889 8:125616190-125616212 AAGAAAAAGAAAAAAGAAACAGG + Intergenic
1047700491 8:127444831-127444853 AAGAACAAGGCATTGGAAACCGG + Intergenic
1047741826 8:127812607-127812629 AAAAAGAAGGAAAGGGAGAGAGG + Intergenic
1047778993 8:128096691-128096713 ATGAACAAGGCAAAGGGGCCTGG - Intergenic
1047798671 8:128285620-128285642 AAGAAGAAGGAGAAGGAAAAGGG + Intergenic
1048560160 8:135527279-135527301 AAGAACAAAGAAGAGGATCCTGG + Intronic
1048685181 8:136896994-136897016 AAGAATCAGAAAATGGAGACTGG + Intergenic
1048718276 8:137293064-137293086 TAGAGCAGGGAAAAGGACACTGG + Intergenic
1048912592 8:139150351-139150373 AAGAAAAATGGGAAGGAGACTGG - Intergenic
1050161504 9:2724451-2724473 AAGAAGAAAAAAAAGAAGACTGG + Intronic
1050245029 9:3680521-3680543 AAGAACAAGGAATAGAACAAGGG - Intergenic
1050358547 9:4805390-4805412 AAGAAGAAGGAGAAGGGGAAGGG + Intronic
1051120540 9:13747415-13747437 AAGTCCAAGGAAAAGAACACAGG - Intergenic
1051171030 9:14317505-14317527 CAGAAAAAGGAAAATGAGATAGG + Intronic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051229233 9:14937046-14937068 AAGAACAAAGAATAGAAGTCAGG + Intergenic
1051630776 9:19138890-19138912 AAGCAAAATTAAAAGGAGACAGG - Intronic
1051712401 9:19945470-19945492 ATGAACATGGAAAAGGGGAAAGG - Intergenic
1051891893 9:21950755-21950777 AAGAAGAAAGAAAAGAAAACTGG + Intronic
1052426728 9:28314453-28314475 TTGAAGAAGGAACAGGAGACAGG - Intronic
1052560166 9:30075328-30075350 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
1052595768 9:30556648-30556670 AAGAACAAGGAAAATGAGTGAGG + Intergenic
1052680542 9:31685943-31685965 AAATACATGGAAAAGGGGACTGG - Intergenic
1052768500 9:32666040-32666062 AGGAGAAAGGAAGAGGAGACAGG + Intergenic
1052976791 9:34417057-34417079 AAGAAGAAGGAGAAGGGGAAGGG - Intronic
1053297518 9:36925363-36925385 AAGAACAAGGCCAGGGGGACAGG + Intronic
1053359142 9:37470918-37470940 AAGAAAAAGGAAAAAGAAAATGG + Intergenic
1053821311 9:41969970-41969992 AACAACAACGAAAAAGAGAACGG + Intronic
1055096111 9:72415796-72415818 AATAAAAAGGAAAGGAAGACAGG - Intergenic
1055150323 9:72990202-72990224 AAAAACAAAGAAAGGGAAACAGG + Intronic
1055436047 9:76293252-76293274 AAGAAAAAGTAAAAGGAGTGTGG + Intronic
1055977446 9:81968844-81968866 GAGAAGAAAGAAAAGGAGAAGGG + Intergenic
1056082167 9:83106713-83106735 AGTAGGAAGGAAAAGGAGACAGG - Intergenic
1056645642 9:88409289-88409311 AAGAAAAAAGAAAAGCAGGCCGG - Intronic
1057447630 9:95128901-95128923 AAAAAAAAAAAAAAGGAGACTGG - Intronic
1057461496 9:95266979-95267001 AGAAAAAAGGAAAAGGATACAGG + Intronic
1057522366 9:95770220-95770242 GAGGACAAGGAAAACGAGATGGG - Intergenic
1057632159 9:96728370-96728392 AAGAACAAGAAAAAGGAAATGGG - Intergenic
1058035405 9:100247196-100247218 AAGAGCACAGTAAAGGAGACTGG - Intronic
1058127055 9:101207270-101207292 AAAAGGAAGGAAAATGAGACAGG + Intronic
1058409458 9:104715263-104715285 AAGAAGAAGGAGAAGGAAAAGGG - Intergenic
1058728791 9:107829422-107829444 ATCAAGAAGGAAAAGGAGAAAGG - Intergenic
1059064687 9:111070582-111070604 AAGAAAAAGGGAAGGGAGAAAGG + Intergenic
1059174395 9:112155870-112155892 AGGAAGAAGGAGAAGGAGAGAGG + Intronic
1059571338 9:115439616-115439638 AAGAAGAAGGGAAAGGAAAAGGG + Intergenic
1059623997 9:116041188-116041210 ATGGAAAAGAAAAAGGAGACGGG + Intergenic
1059760475 9:117332584-117332606 AACAACAACAAAAAGGACACAGG + Intronic
1059927041 9:119219922-119219944 AAGAGCATGGAAAAGGCCACGGG + Intronic
1059973759 9:119694318-119694340 AATGAGAAGGAAAAGGAGAGAGG - Intergenic
1060200404 9:121649044-121649066 AGGAAGAAGGAAAAGGAGCCTGG + Intronic
1060342304 9:122788409-122788431 AAGAAAAAAGAAAAAAAGACGGG + Intergenic
1060430302 9:123545460-123545482 AAAAAAAAAGAACAGGAGACAGG - Intronic
1060489450 9:124071762-124071784 AAGAAAAAGAACAAGGAGAAGGG - Intergenic
1060838603 9:126777210-126777232 AAGATAAAAGAAAAGAAGACAGG + Intergenic
1061097323 9:128466163-128466185 AAGAAAAACGAAAAGAGGACTGG + Intronic
1061104858 9:128522218-128522240 AAGATCAAGCAAAAGGAGAAAGG + Intronic
1061166626 9:128926534-128926556 AAGAAAAAGAAAAAGGAAGCTGG - Intronic
1061184647 9:129045460-129045482 AAAAAAAAGCAAAAGTAGACCGG + Intronic
1061691569 9:132336571-132336593 AAGAACACAGAAAAGAAAACAGG + Intronic
1061738187 9:132677521-132677543 AAGAACTAGGCAAGGGAGCCGGG + Intronic
1061946425 9:133910836-133910858 AAGAAAAAGAAAAAGAAAACTGG + Intronic
1062462789 9:136668861-136668883 AAGAGCAAGGATTAGGACACTGG - Intronic
1062497923 9:136840361-136840383 AAGAGCAAGGACAAGGAGGAGGG + Exonic
1185611093 X:1394136-1394158 AAGAAAAAAGAAAAGGAGGCGGG - Intergenic
1185611105 X:1394206-1394228 AAGAAAAAGGAAAAGGAGGGAGG - Intergenic
1185637477 X:1563520-1563542 AAGAAAAAGAAAAAAGAGAAAGG + Intergenic
1185741386 X:2535623-2535645 AAGAAAAAGGAAAAAGAAATAGG - Intergenic
1185772234 X:2773460-2773482 AAGAAGGGGGAAAAGGAGAGAGG + Intronic
1185996826 X:4960885-4960907 ATGAACAAGGAAAGGGAAACAGG + Intergenic
1186053662 X:5626714-5626736 AAGAAGGAGGGAAAGGAGAAAGG + Intergenic
1186074007 X:5856326-5856348 AAGAAGAAGGAAAACAAGAGTGG + Intronic
1186177571 X:6941312-6941334 AAGAAAAAGAAAAAAGAAACTGG - Intergenic
1186264625 X:7818772-7818794 AAAAAGAAGGAAAAGGAGAAGGG + Intergenic
1186471173 X:9823132-9823154 AGGAAGAAGGAGAAGGAGAAGGG - Intronic
1186592424 X:10944903-10944925 ACAAACAAGCAAATGGAGACAGG - Intergenic
1186826208 X:13342333-13342355 AAGAAAAAGTAAAAGGATCCTGG - Intergenic
1187059108 X:15768899-15768921 AAGTGCAAGGAAAAGGAGCTGGG + Intronic
1187628909 X:21146317-21146339 AAAAAAAAGGAAAAGGAAATAGG - Intergenic
1187644916 X:21336541-21336563 TAAAAAAAGAAAAAGGAGACAGG + Intergenic
1187672828 X:21685671-21685693 GAGAACAGGCAAAAGGTGACAGG - Intergenic
1187765944 X:22642274-22642296 AAGAACATGGAACAGCATACTGG - Intergenic
1188033208 X:25287805-25287827 AAGAAGAAGGAAAAAGAGAGGGG - Intergenic
1188308528 X:28587929-28587951 AAAAACAAGAAAAAGAACACAGG + Exonic
1188559173 X:31448273-31448295 GATAAAAAGGAAAAGGAGGCAGG + Intronic
1188809485 X:34635346-34635368 AAGAGTATGGAAAATGAGACGGG - Intronic
1188937842 X:36199205-36199227 AATAAAAAGGAAAAGGAGAGAGG - Intergenic
1189245014 X:39556712-39556734 AAGATAAAGGATAAGGAGAGAGG + Intergenic
1189250173 X:39594591-39594613 AAGAACAAAGAAAAAGAGTGAGG - Intergenic
1189425575 X:40897125-40897147 AAGAAAAAGAAAAAGAAGACTGG + Intergenic
1189457904 X:41210955-41210977 AAGGAAAAGAAAAAGGAGAAAGG - Intronic
1189580215 X:42398079-42398101 AAGAAGAAGGAAAAGCACATGGG - Intergenic
1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1189712581 X:43828629-43828651 AAAGACAAGGAAAAGGATAAGGG - Intronic
1189789349 X:44588639-44588661 AAAAAAAAGGAAAAGGAATCTGG - Intergenic
1189810790 X:44778967-44778989 ATGAAGAAGGAAAAGAGGACTGG - Intergenic
1189940232 X:46113307-46113329 GAGAGCAAGGAAAAGCAGAATGG - Intergenic
1189984098 X:46538593-46538615 AAAAAAAATGAAAAGAAGACTGG + Intronic
1189986103 X:46554653-46554675 TAGAAAATGGAAAAGGAGTCTGG + Intergenic
1190466912 X:50734389-50734411 AAGAAAAAGAAAGATGAGACTGG - Intronic
1190769887 X:53505487-53505509 AAGAAAAAGAAAAAGAAAACAGG - Intergenic
1190819203 X:53957785-53957807 AAGCAAAAGGAAAAAGGGACAGG - Intronic
1191185653 X:57608064-57608086 AAGAGCAAGGAAAAGCAGGGTGG - Intergenic
1191740284 X:64429746-64429768 TAAAACAAGGAAAAGGAAGCAGG + Intergenic
1191984353 X:66962435-66962457 AGGAACAAGAAAAACAAGACAGG - Intergenic
1192161413 X:68790877-68790899 AAAAAGAAGGAAGAGGAGAAAGG - Intergenic
1192206816 X:69101854-69101876 AAGAGCAAGGAAAGGGGGGCCGG - Intergenic
1192436443 X:71146103-71146125 AAGAAAAAGGAAGAGGAGGGAGG - Intronic
1192552317 X:72064355-72064377 CAGCAGAATGAAAAGGAGACAGG + Intergenic
1192831653 X:74756529-74756551 AGGAGCAAGGGAAAGGATACAGG + Intronic
1193311665 X:80017034-80017056 AAAAACAAAGAAAAGGAAAGAGG + Intronic
1193844920 X:86456123-86456145 AAGAACAAAGAAAAGCAGGGTGG - Intronic
1193956032 X:87863955-87863977 AGGAACATTGAAAAGCAGACTGG - Intergenic
1194060025 X:89184739-89184761 AAGAAGAAGGACAAGTACACTGG + Intergenic
1194218908 X:91167557-91167579 AAGAAGAGGGAAAAGTAGAGGGG - Intergenic
1194220130 X:91179390-91179412 AAGAATAAGGACAGGCAGACTGG + Intergenic
1194315398 X:92369954-92369976 AAGAACTAGAAACAGGAGAGGGG - Intronic
1194391828 X:93328272-93328294 CTGAACAAGGAAAAAGAGATAGG + Intergenic
1194423732 X:93710122-93710144 AAGAAGAAGAAAAAGAAGTCTGG + Exonic
1194514336 X:94832232-94832254 AACAAAAATGGAAAGGAGACAGG + Intergenic
1194984928 X:100480079-100480101 AAGAACTCAGCAAAGGAGACTGG - Intergenic
1194996418 X:100596025-100596047 AAGATTAAGGCAAAGGAGGCGGG + Intronic
1195101604 X:101560581-101560603 AGGAACAAGGGAAAGGGGAAAGG - Intergenic
1195104971 X:101594476-101594498 AAGAACAAAGAAAAGCAAAGCGG - Intergenic
1195318451 X:103701148-103701170 AGGAAGAAGGAAAAGGAGGAGGG - Intergenic
1195339355 X:103890908-103890930 AAGAAAAAGAAACAGGAGAAAGG - Intergenic
1195339356 X:103890915-103890937 AAGAAAAAAGAAAAAGAAACAGG - Intergenic
1195508030 X:105681248-105681270 GAGAACAAGGAGGAGGAGACAGG + Intronic
1195555995 X:106225025-106225047 AAGAAAAAGAAAAAAGAGCCTGG + Intergenic
1195877539 X:109557864-109557886 AAAAACAAAAAACAGGAGACAGG + Intergenic
1195930128 X:110066096-110066118 AAGAAGAATGAAAATGAGAAAGG - Intronic
1195973966 X:110505161-110505183 AAGGAAAAGGAGAAGGAGAAGGG - Intergenic
1196202816 X:112905242-112905264 AATGACAAGGGACAGGAGACAGG + Intergenic
1196206128 X:112942081-112942103 AACAAAAAGGAAAAGGAGGAAGG - Intergenic
1196245635 X:113396123-113396145 AAAAACAAGGATCAGGAGACAGG - Intergenic
1196250933 X:113459446-113459468 CAGAACAAAGAAAGGGATACAGG + Intergenic
1196495344 X:116318022-116318044 AAGAACAAGGAGCAGTAGCCAGG + Intergenic
1196567121 X:117221436-117221458 ATGAATAAGAAAAAGGAGAGGGG - Intergenic
1197200514 X:123744729-123744751 AAGAAAAAAGAAAAGGAAAAGGG + Intergenic
1197360523 X:125497098-125497120 AGGTAACAGGAAAAGGAGACTGG - Intergenic
1197457142 X:126691115-126691137 AAGAACATGAAGAAGGAGAAGGG + Intergenic
1197556260 X:127958660-127958682 AAAAACAAGAAAAAGTAGCCAGG + Intergenic
1197657469 X:129132734-129132756 AAGAACCCGCAAAAGGAAACTGG + Intergenic
1197767869 X:130070813-130070835 AAGAAAAAGGAAAAGAAAAAAGG + Intronic
1197793855 X:130280775-130280797 GAAAACAAGGAAAAGGACTCAGG - Intergenic
1197904825 X:131413430-131413452 AAGAAGAAAGAAAAGGGAACGGG + Intergenic
1197967111 X:132076895-132076917 CAGAACATGGAAAAGGAGGGAGG - Intergenic
1198041141 X:132853512-132853534 AACAAGAAGTAAAATGAGACAGG + Intronic
1198080123 X:133231809-133231831 AAGAAAGAAGAAAAGGAGAAAGG + Intergenic
1198444826 X:136702001-136702023 AAGAATAAGAAAAATGAGGCCGG - Intronic
1198492750 X:137159114-137159136 AAAAAAAAGGAAAAGAAAACAGG + Intergenic
1198645615 X:138802680-138802702 AGCAACTAGGAAAAGGAGGCAGG - Intronic
1198714479 X:139542277-139542299 TAAAAAAAGGAAAAGGTGACAGG + Intronic
1198755692 X:139979724-139979746 AAGAAAAAAGAAAAGGAGAAAGG + Intergenic
1199194331 X:145009183-145009205 AAGAACAAGGACAATTTGACTGG + Intergenic
1199316576 X:146385545-146385567 ATGAAAAAGAAAAAGGAGAGTGG + Intergenic
1199702918 X:150398387-150398409 AAGAAGAAGAAGAAGAAGACAGG + Intronic
1200375483 X:155775281-155775303 GAGAAAAAGTAAAAGCAGACAGG - Exonic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1200555420 Y:4631313-4631335 AAGAAGAGGGAAAAGTAGAGGGG - Intergenic
1200556642 Y:4643147-4643169 AAGAATAAGGACAGGCAGACTGG + Intergenic
1200582202 Y:4963846-4963868 AAGAAGAGGGAAAAGGAAAGGGG - Intergenic
1200623448 Y:5481489-5481511 AAGAACTAGAAACAGGAGAGGGG - Intronic
1200783805 Y:7240898-7240920 AAAAAGAAAGAAAAGGAGAAAGG - Intergenic
1201274035 Y:12282267-12282289 AAAAAGTAGGAAAAGGAGAACGG + Intergenic
1201453010 Y:14136342-14136364 AAAGACAAGGAAAAGGAGAAGGG - Intergenic
1201458890 Y:14201170-14201192 AAGAAAAAGGAAAGGGAGAGGGG + Intergenic
1201678307 Y:16613223-16613245 ATGAACAAGGAAAGGGAAACAGG - Intergenic
1201927406 Y:19302811-19302833 AAGAAGAAGGAAAAGAAGCAAGG - Intergenic
1202143497 Y:21753518-21753540 AAGAAAAAGAAAAAGTAGATAGG - Intergenic
1202339525 Y:23847791-23847813 AAGAGCAAGGAAAAGGTCCCTGG + Intergenic
1202531241 Y:25822277-25822299 AAGAGCAAGGAAAAGGTCCCTGG - Intergenic