ID: 921113603

View in Genome Browser
Species Human (GRCh38)
Location 1:212064305-212064327
Sequence CAGGCACAGGATGTTGTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 245}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921113603 Original CRISPR CAGGCACAGGATGTTGTCAG TGG (reversed) Intronic
900374540 1:2347440-2347462 CAGGCACAGGCTGTCTCCAGGGG + Intronic
901373781 1:8822738-8822760 GAGCCACAGCATGTTGTCTGGGG + Intergenic
903926079 1:26831697-26831719 CAGGCACAGGCTATTCTCTGAGG + Intronic
905684173 1:39897028-39897050 CAGGTGGTGGATGTTGTCAGGGG - Exonic
906223546 1:44102746-44102768 CTGGCGCAGGATGTTGATAGTGG + Intergenic
906796490 1:48700298-48700320 CATGGACAGGATACTGTCAGAGG - Intronic
907328131 1:53654015-53654037 CAGACACAGGAGGCTGTGAGAGG + Intronic
909878119 1:80836793-80836815 AAGGGACAGGGTATTGTCAGGGG + Intergenic
910734704 1:90440594-90440616 CATGGACAGAATGATGTCAGAGG + Intergenic
911229904 1:95349956-95349978 AAGACAGAGGATGTTGTTAGTGG - Intergenic
912075306 1:105867029-105867051 TAGGCACAGAATGTAGGCAGAGG - Intergenic
914334367 1:146701223-146701245 CAGCCACAGGAAGTTGCTAGGGG - Intergenic
917931850 1:179828026-179828048 CAAGCACATGATGATGGCAGAGG + Intergenic
921113603 1:212064305-212064327 CAGGCACAGGATGTTGTCAGTGG - Intronic
921422528 1:214964800-214964822 CTGGCACTGGAAGTTGACAGTGG - Intergenic
922009054 1:221563243-221563265 CCGGCTCTGGATGTTTTCAGAGG - Intergenic
922247585 1:223815729-223815751 CATGCACTGCATGTTGACAGTGG + Intronic
922758137 1:228108027-228108049 GAGCCACAGGCTGTGGTCAGAGG + Exonic
923965923 1:239139018-239139040 CAAGCACAGGATGTTGTGGTGGG + Intergenic
1063700021 10:8375315-8375337 AAGCCACAAGATGTTGTCATCGG - Intergenic
1064326407 10:14355395-14355417 AAGGAACAGGATGGGGTCAGTGG - Intronic
1065941640 10:30569578-30569600 CTGGTCCAGGATGTTGACAGTGG - Intergenic
1066490579 10:35890166-35890188 CAGACACAGGAAGAGGTCAGTGG - Intergenic
1066680541 10:37933511-37933533 CATGCACTGGATATTGTCAGAGG - Intergenic
1069240300 10:66130029-66130051 CAGGGGCAGGATGCTGGCAGAGG - Intronic
1070276754 10:75014655-75014677 ATGGCACAGGAAGTTGTTAGAGG + Intronic
1071178614 10:82956775-82956797 CAGCCACAAGATTTTATCAGGGG - Intronic
1073190338 10:101646456-101646478 GAGGCACAGGTGGTTCTCAGAGG + Intronic
1074161945 10:110842828-110842850 CAGGAACAGGAGGTAGGCAGTGG - Intergenic
1074555330 10:114484048-114484070 CTGGCTAAGGCTGTTGTCAGGGG - Intronic
1075414991 10:122255978-122256000 CAAGCAAAGGATGCTGGCAGTGG - Intergenic
1076438879 10:130465678-130465700 CAGACACACGAAGATGTCAGAGG + Intergenic
1078558436 11:12350319-12350341 AAGCCACAGGAAGTGGTCAGGGG - Intronic
1079123472 11:17701532-17701554 CTGGTGCAGGATGTTGACAGTGG - Intergenic
1079239288 11:18711155-18711177 CAGACACTAGTTGTTGTCAGTGG - Intronic
1080689594 11:34545334-34545356 CAGGCCCAGGAAGGGGTCAGTGG + Intergenic
1080915077 11:36649065-36649087 CAGGCACAAGAAGTTGTTAAGGG + Intronic
1082222667 11:49659163-49659185 CAGGTAAAGCATGTTCTCAGTGG - Intergenic
1084069616 11:66725894-66725916 CAGGAGCAGGATGTGGTGAGAGG - Intronic
1084729399 11:71063895-71063917 CAGGCACACTGTGTTCTCAGCGG - Intronic
1085232975 11:74988879-74988901 CGGGCGCAGGCTGTAGTCAGTGG - Exonic
1088524213 11:110735202-110735224 CAGGCACAGGATCTCCTGAGAGG + Intergenic
1088646271 11:111919104-111919126 CAGGCAGAGGAAGGTGGCAGTGG - Intronic
1088991622 11:114958897-114958919 CTGGCAGAGGATGTTGATAGTGG + Intergenic
1089052684 11:115559303-115559325 CAGGCTCAGGATCTTCCCAGAGG - Intergenic
1091765872 12:3119653-3119675 GGTGCACAGGATGTGGTCAGTGG - Intronic
1092051545 12:5474414-5474436 CTGGCACAGGGAGTTGTCAGGGG + Intronic
1093645476 12:21581285-21581307 CAGGCCCAGGATGTGGTCTCAGG - Intronic
1094104904 12:26800966-26800988 CAGGGACAGGAGGTACTCAGAGG + Intronic
1095374582 12:41511390-41511412 CAGCATCAGGATGATGTCAGTGG + Intronic
1097256511 12:57679908-57679930 CTGGGGCAGGATGTTGACAGTGG + Intergenic
1098652319 12:72988573-72988595 TAGGTACAGGATGTTGATAGTGG + Intergenic
1101334746 12:103786452-103786474 GAGGCAGAGGATGTCTTCAGAGG + Intronic
1101816318 12:108148812-108148834 TAATCACAGGATATTGTCAGGGG - Intronic
1103087654 12:118073883-118073905 CAGCCACAGGATCTTGGCAGGGG + Exonic
1103996193 12:124831701-124831723 CAGGCACAGGAAGTTGTATCAGG - Intronic
1109674297 13:65653743-65653765 CAGGCACATTCTGGTGTCAGAGG + Intergenic
1111735807 13:92137972-92137994 CTGGTGCAGGATGTTGACAGTGG + Intronic
1111997438 13:95178695-95178717 CGAGCACAGGATGATGGCAGGGG + Intronic
1113545787 13:111148477-111148499 CAGGCACAGGATGGTTTTAAGGG + Intronic
1113928415 13:113953587-113953609 CAGACACAGGAGCTTGGCAGTGG - Intergenic
1114551019 14:23532978-23533000 CAGGGACAGGCTGTCGTCTGGGG + Exonic
1118680143 14:68232657-68232679 CAGACATAGGATATTGTCAGAGG + Intronic
1118820911 14:69345320-69345342 GAGGCACAGGCTGCTGCCAGGGG + Intronic
1120085145 14:80263426-80263448 CAGGGACAGAATGTGGTCTGAGG + Intronic
1120227878 14:81811093-81811115 CAGGAACAGGAAATTGTGAGAGG - Intergenic
1122372211 14:101234963-101234985 CAGGCCCAGGAGGGTGGCAGAGG - Intergenic
1123675470 15:22706948-22706970 CTGGTGCAGGATGTTGACAGTGG + Intergenic
1124327463 15:28779894-28779916 CTGGTGCAGGATGTTGACAGTGG + Intergenic
1124411415 15:29440716-29440738 GAGGCAGAGGATGGTGACAGTGG - Intronic
1124529471 15:30491892-30491914 CTGGTGCAGGATGTTGACAGTGG + Intergenic
1124769184 15:32515792-32515814 CTGGTGCAGGATGTTGACAGTGG - Intergenic
1126496168 15:49293040-49293062 CAGGCACAGGATGGAGTCTTGGG + Intronic
1127538894 15:59917879-59917901 CAGTCACAGCATGGGGTCAGAGG + Intergenic
1127673952 15:61222748-61222770 CAAGCACAGGTTGTTTTCACTGG - Intronic
1129328749 15:74816151-74816173 CAGGCCCAGGATGGCGTCTGTGG - Exonic
1130917956 15:88320868-88320890 CAGACACAGGATGGTGTGTGTGG - Intergenic
1132364843 15:101250035-101250057 CAGGCACTAGATGTTGTGAGGGG - Intronic
1132630560 16:915278-915300 CAGGCACAGGATGGGGGCAGAGG + Intronic
1132884575 16:2177002-2177024 CAGGCACTGGCTGCTGTGAGTGG + Exonic
1132895841 16:2229038-2229060 CAGGCTCAGAAAGTGGTCAGTGG + Intronic
1132994117 16:2814110-2814132 CAGGCACAGGGAGTGGGCAGCGG + Intergenic
1134850578 16:17475274-17475296 CAGGCGCGGGATGGGGTCAGAGG + Intergenic
1136558711 16:31025531-31025553 CTGGCTCAGGAGGTTCTCAGTGG + Intergenic
1136928510 16:34397072-34397094 CAGGCAGATTATGTGGTCAGAGG - Intergenic
1136976064 16:35014732-35014754 CAGGCAGATTATGTGGTCAGAGG + Intergenic
1137278754 16:46957107-46957129 GAGGCTCAGGAGGTGGTCAGAGG - Exonic
1139999250 16:71010009-71010031 CAGCCACAGGAAGTTGCTAGGGG + Intronic
1140065964 16:71611312-71611334 CAAGCACAGGATGTGCTGAGTGG + Intergenic
1140191758 16:72823477-72823499 CAGACACACTGTGTTGTCAGAGG - Intronic
1140215087 16:73000653-73000675 CACACACTGGATGTTTTCAGCGG + Intronic
1140363023 16:74360714-74360736 CAGGCACAGGTGGTCGTCTGTGG - Intergenic
1143055005 17:4156126-4156148 CAGGCACCGGAAGCTGTCTGAGG + Intronic
1143396150 17:6599003-6599025 CAGCCACAGGTTTTTGTTAGTGG - Intronic
1144998184 17:19285462-19285484 CAGGGTCAGAATGTGGTCAGTGG + Intronic
1145783908 17:27581841-27581863 CAGGCACAGGATCATGGTAGGGG + Intronic
1147235636 17:39055516-39055538 CAGGCACAGGGTGTTGTGCCTGG - Intergenic
1150806668 17:68324907-68324929 GAAGCACAGGATGTTCTCAAAGG - Intronic
1151811690 17:76447057-76447079 GAGGCACAGGATGTTGGGATAGG - Intronic
1151885319 17:76920139-76920161 CAAGCACTGGCTGTTGGCAGTGG + Intronic
1152678514 17:81653719-81653741 AAGGGGCAGGAAGTTGTCAGTGG - Intronic
1157598226 18:48876636-48876658 CAAGCACAGGGGGGTGTCAGAGG - Intergenic
1157640691 18:49210745-49210767 CTGGCACAGGATGTTGATAGTGG + Intronic
1157995583 18:52551126-52551148 CAAGCAGAGAATGTGGTCAGTGG + Intronic
1158388793 18:57025755-57025777 CAGCAGCAGGATGGTGTCAGAGG - Intronic
1159954955 18:74512722-74512744 CAGGCACAGGAGGGTTTCAGGGG - Intronic
1162688894 19:12412716-12412738 CAGGGACAGGATGTGGGCCGTGG - Intronic
1163567682 19:18061153-18061175 CTGGCACAGGGTGTGGGCAGCGG + Exonic
1164521768 19:28985112-28985134 CAGGCGCTGGATGCTGACAGTGG - Intergenic
1165809875 19:38605847-38605869 GGGGCACAAGATGTTGTCGGGGG - Intronic
1167762199 19:51456999-51457021 CAGGGACAGGATGGGGACAGGGG + Intronic
925987347 2:9226942-9226964 CTGGGATAGGCTGTTGTCAGTGG + Intronic
926196091 2:10764495-10764517 CAGGCTGAGGCTGTTGGCAGGGG - Intronic
926305904 2:11637095-11637117 CAGGGACAGGATGCCTTCAGTGG + Intronic
926390783 2:12390418-12390440 CAGGAACAGCATTTTGTCAAGGG + Intergenic
928735789 2:34287493-34287515 GAGGGAAAGGATGTTGTTAGAGG - Intergenic
928909839 2:36408510-36408532 CTGGCAAAGGATGCTGTGAGTGG + Intronic
932174354 2:69585977-69585999 CAGGCAGAGGGTGGTGCCAGAGG - Intronic
932781391 2:74560766-74560788 CTGGCACAGGATGTTGTGGCCGG - Intronic
933554217 2:83811429-83811451 CAGCCACTGGATTTTGCCAGTGG - Intergenic
933774495 2:85764046-85764068 CAGGGACAGGATGTAGTTACAGG - Exonic
936045886 2:109187799-109187821 ATGGCAGAGGATGGTGTCAGAGG - Intronic
936227416 2:110669290-110669312 CAGGCCCAGGAAGTTGCCACAGG + Intronic
937131544 2:119517792-119517814 TAGGGACAGGCTGTTGTCTGGGG + Intronic
939864431 2:147456973-147456995 CAGGCTCAGCATGCTCTCAGGGG - Intergenic
940098268 2:150003664-150003686 CAGGCACGCCATGTTGCCAGTGG + Intergenic
942372340 2:175298794-175298816 CACACACTGGATCTTGTCAGTGG + Intergenic
944507425 2:200426933-200426955 CAGACACAGGATGTAGTGATAGG + Intronic
945080536 2:206084012-206084034 CAGGGACAGGATGTTTCCCGTGG - Intronic
946174293 2:217913126-217913148 CTGGCAGAGGATGCTGGCAGTGG + Intronic
946666364 2:222053758-222053780 CAGGCACAGACTGTTGTTAAAGG - Intergenic
947660188 2:231860727-231860749 CAGGCACAGGCTGCCGTCACTGG + Intergenic
948155117 2:235775239-235775261 TTGGCACAGGATTTTGTCATGGG + Intronic
948844759 2:240677729-240677751 CAGGAAAGGGATGCTGTCAGAGG + Intronic
948849101 2:240697150-240697172 CAGGAAAGGGATGCTGTCAGAGG - Intronic
1169162867 20:3397174-3397196 GAGGCAGAGGTTGCTGTCAGTGG + Intronic
1170897973 20:20433449-20433471 CAGGCACAGGATATCTCCAGAGG + Intronic
1171185575 20:23121875-23121897 CAGGCACAGGATGGTGGGGGTGG + Intergenic
1171230792 20:23482602-23482624 CACGCACAGGATGTAAGCAGGGG - Intergenic
1172245439 20:33442824-33442846 CAGGCACAGGCTGGGGTCACAGG - Intronic
1173628197 20:44489432-44489454 CTGGCCCAGGATGCTGTCACAGG - Exonic
1175931250 20:62494802-62494824 CAGATACAGGAAGTTGGCAGGGG + Intergenic
1176704360 21:10100995-10101017 CAGGCACATGGTGTTGTTGGTGG + Intergenic
1179602074 21:42485974-42485996 CAAGCACAGGACATTGCCAGAGG + Intronic
1180731867 22:17988319-17988341 CTGGAACAGGATGTTGGCAGTGG - Intronic
1181236027 22:21448155-21448177 CAGGCACTGGGTGCTGACAGGGG + Exonic
1181727539 22:24821862-24821884 CTGGCCGAGGATGTTGACAGTGG - Intronic
1183192788 22:36332419-36332441 CAGGCACACAATGTGGTCATGGG + Intronic
1184333548 22:43840519-43840541 CAGCCACAGGATCTGCTCAGGGG + Intronic
1185050909 22:48553509-48553531 CAGGGACAGGATGGTGGGAGAGG + Intronic
949720483 3:6984003-6984025 CAGGCATAGGACATTGACAGGGG + Intronic
951465954 3:23000717-23000739 AAGGGACAGGATGCTGTCCGCGG + Intergenic
952591926 3:34966189-34966211 CTTGCAGAGAATGTTGTCAGGGG - Intergenic
953349296 3:42202627-42202649 CAGGGACATGATGCTCTCAGTGG - Exonic
953680401 3:45034754-45034776 TGGGCACAGGCTGTGGTCAGAGG - Intronic
954001797 3:47563491-47563513 CAGGTTCAGGAGTTTGTCAGAGG - Intronic
954333826 3:49904698-49904720 CAGCGACAAGATGGTGTCAGAGG + Intronic
954467960 3:50668162-50668184 CAGGGAAAGAATGTTGCCAGGGG - Intergenic
960339126 3:116453853-116453875 CAGGCTCAGGAAGTTGTCTTAGG + Intronic
960611066 3:119555192-119555214 CTGGCGCAGGATGTAGACAGTGG - Intronic
961385241 3:126519580-126519602 CAAGCACAGGTTGTGGTCTGTGG - Intergenic
961804342 3:129478196-129478218 CTGGCACAGGATGATGTGATTGG - Exonic
962716394 3:138129433-138129455 CAGCCACAGAAGCTTGTCAGAGG + Intronic
963186103 3:142419142-142419164 CAGACACAGGAAGTTGGTAGAGG - Intronic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
966715032 3:183006178-183006200 CAGGCAGAGGTTGTAGTGAGCGG + Intergenic
967959500 3:194909146-194909168 CCAGCTCTGGATGTTGTCAGCGG - Intergenic
967961770 3:194931163-194931185 CAGGGACAGAAGGATGTCAGAGG + Intergenic
968023281 3:195415168-195415190 CTGGTACAGGATGTTGATAGTGG + Intronic
968360759 3:198145150-198145172 CAGCCACAGGAGGTGGTGAGTGG - Intergenic
968546590 4:1202067-1202089 CAGGCACAGGACGTCTTCTGCGG - Intronic
968592534 4:1466144-1466166 CTGGCACAGGGTGTGGGCAGTGG - Intergenic
969346450 4:6573628-6573650 CACCCACAGGAGGTTGTTAGGGG + Intergenic
969843369 4:9900294-9900316 GAGCCAAAGGATGTTATCAGAGG + Intronic
970856896 4:20659582-20659604 TAGGCACAGGATGAGGTCAGAGG + Intergenic
974050341 4:56936262-56936284 AAGTCACAGCATGTTGTCTGAGG + Intergenic
976209084 4:82649537-82649559 CAGCCACAGAATCCTGTCAGTGG - Intronic
976745492 4:88399228-88399250 CTGGCACAGAATGTGGTCAGAGG + Intronic
977557962 4:98503836-98503858 CTGTCACTGGATGTTGTCAAGGG + Intronic
983753860 4:171309729-171309751 AAAGCAAAGTATGTTGTCAGAGG + Intergenic
985420516 4:189780913-189780935 AAGCCACAGGATGTTGTCCCTGG + Intergenic
985513489 5:325143-325165 GGGGCAGGGGATGTTGTCAGAGG - Intronic
985959552 5:3290324-3290346 CAGGCAGAGGTTGCTGTGAGTGG - Intergenic
988332942 5:29866093-29866115 CAGGTGCAGGATATTGACAGTGG + Intergenic
988997084 5:36724994-36725016 CAAGCACAGGGTGCAGTCAGTGG - Intergenic
990893341 5:60671498-60671520 CAAGCAAAGGATGCTGTTAGAGG - Intronic
992526965 5:77621001-77621023 GAGGCTAATGATGTTGTCAGTGG + Intergenic
994792075 5:104241281-104241303 CAGGGACACGCTGTTGCCAGCGG - Intergenic
996331495 5:122334568-122334590 CTAGCACAGGTTCTTGTCAGTGG + Intronic
1001163163 5:169339344-169339366 CAGGCAAAGCATATTGACAGAGG - Intergenic
1001221658 5:169905498-169905520 CAGGCAGAGTATGTTGGGAGAGG + Intronic
1002307776 5:178293860-178293882 GAGGGACAGGCTGTTGTCAGAGG + Intronic
1002565154 5:180108786-180108808 CAGGGCCAGGTTTTTGTCAGAGG + Intronic
1004066165 6:12246498-12246520 CACGCCCAGGATCTTGCCAGTGG - Intergenic
1005018857 6:21398934-21398956 AAGGCACAGGATGAGATCAGAGG + Intergenic
1005523048 6:26617016-26617038 CTGGTACAGGATGTTGATAGTGG + Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006072288 6:31506648-31506670 CAGGCTCAGGCTTCTGTCAGAGG - Intronic
1006434457 6:34019032-34019054 CAGGCTCAGCATCTTCTCAGGGG + Intronic
1006909540 6:37555119-37555141 CAGGCACAGGGACTTGCCAGTGG - Intergenic
1008000255 6:46352711-46352733 CAGAAACAGGAAGTTGTCAGGGG + Intronic
1008673175 6:53794219-53794241 CAGCCACAGCTAGTTGTCAGGGG + Intergenic
1008715870 6:54288946-54288968 CAGCCACCGGATGTTGCTAGTGG - Intergenic
1008760862 6:54849531-54849553 GGGGCAAAGGATGTTTTCAGGGG + Intronic
1009158072 6:60247951-60247973 CAGGCACAGGATGAGATAAGGGG - Intergenic
1011637547 6:89388304-89388326 TAGACACAGAATGTTTTCAGGGG + Intronic
1013305220 6:108841388-108841410 CAGGAGGAGGTTGTTGTCAGGGG - Intergenic
1014041652 6:116834141-116834163 CAGGCACATGAAGTTGTTGGTGG - Intergenic
1016684030 6:146861295-146861317 CAGTACAAGGATGTTGTCAGAGG + Intergenic
1018465559 6:164041185-164041207 CACACACAGGATGATGTCACAGG - Intergenic
1019062592 6:169266772-169266794 CAGGCACAGGATCCAGTCACGGG - Intergenic
1019075768 6:169387106-169387128 CAGGCACAGGAAGGAGCCAGGGG + Intergenic
1019087137 6:169489191-169489213 CATGCACAGGAGGTGCTCAGCGG - Intronic
1019109830 6:169701184-169701206 AATGCACAGGATTTTATCAGTGG - Intronic
1022117211 7:27272416-27272438 CAGGCACAGGGTTGTGTGAGGGG + Intergenic
1022174496 7:27860662-27860684 GAGGCAGAGTATCTTGTCAGAGG + Intronic
1022751850 7:33236509-33236531 CAGGCATAGTATATTGTAAGGGG - Intronic
1023138565 7:37078073-37078095 CAGGCCCATGATGCTTTCAGAGG + Intronic
1024056012 7:45660324-45660346 AAGGCTCAGGACGGTGTCAGTGG - Intronic
1026564191 7:71476250-71476272 AAGGCACAAGATGTTAGCAGTGG + Intronic
1026724731 7:72862460-72862482 CAGGAACAGCATGTTTTCAAAGG + Intergenic
1029365020 7:100111160-100111182 CCGGGACTGGATGTTGTTAGTGG + Exonic
1030944411 7:115698969-115698991 TAGGCATAGGATGTAGTCAAAGG + Intergenic
1031841940 7:126752868-126752890 CAGAAACAGGATATTGTCAGAGG - Intronic
1032613374 7:133440559-133440581 AAGTCACAGGATGTGATCAGAGG + Intronic
1033621799 7:143068637-143068659 CAAGCACAGCCTGTTGACAGTGG + Intergenic
1034451664 7:151140140-151140162 CGGGCACAGGAGGTGGGCAGTGG + Intronic
1034852551 7:154508467-154508489 CTGTCACAGGAAGTTTTCAGGGG + Intronic
1034876350 7:154728071-154728093 CAGCATCAGGCTGTTGTCAGGGG + Intronic
1035889295 8:3326123-3326145 CAAGCACAGAATGGTTTCAGTGG + Intronic
1038003631 8:23411620-23411642 CAAGCACAGGAAGTTGTTGGAGG - Intronic
1043614198 8:82105002-82105024 CTGGCTTAGGATGTTGGCAGAGG + Intergenic
1043762433 8:84084555-84084577 TAGGAACAGGTGGTTGTCAGGGG + Intergenic
1044408900 8:91863262-91863284 TATGCACAGCATGTTGCCAGAGG - Intergenic
1048277050 8:133074608-133074630 CAGGGGCAGGATGCTGCCAGAGG - Intronic
1048283522 8:133123252-133123274 CAGGGACAGCATCTTGGCAGGGG - Intronic
1049684784 8:143934937-143934959 CAGGCACGGGCGGCTGTCAGGGG + Intronic
1049909230 9:249329-249351 GAGTCACAGGCTGTGGTCAGAGG - Intronic
1050443650 9:5694459-5694481 TAGACACGGGATGTTTTCAGAGG - Intronic
1050555813 9:6788879-6788901 CAGGCAGAGGCTGCTGTGAGGGG + Intronic
1052851548 9:33381349-33381371 CAGGGACAGGAGGATGCCAGAGG + Intergenic
1053135746 9:35649491-35649513 CAGGCACAGGAAGTGGGCGGTGG - Exonic
1053542915 9:38993498-38993520 CAGGGGCAGGGTGTTGGCAGGGG + Intergenic
1053641621 9:40088011-40088033 CAGGCACATGGTGTTGTTGGTGG + Intergenic
1053764514 9:41377453-41377475 CAGGCACATGGTGTTGTTGGTGG - Intergenic
1054322509 9:63685400-63685422 CAGGCACATGGTGTTGTTGGTGG + Intergenic
1054543130 9:66288630-66288652 CAGGCACATGGTGTTGTTGGTGG - Intergenic
1056726682 9:89125463-89125485 CTGGCACACCATATTGTCAGAGG + Intronic
1061330208 9:129887658-129887680 AAGGCACAGAAGGTTGTCATGGG - Exonic
1061626119 9:131841680-131841702 TAGTCACAGGATGTAGACAGAGG - Intergenic
1062388948 9:136326603-136326625 AAGGCCCAGGATGCTGTCGGGGG + Intergenic
1062614198 9:137388635-137388657 CAGGCAGCGGATGCTGGCAGGGG + Intronic
1202789397 9_KI270719v1_random:71097-71119 CAGGCACATGGTGTTGTTGGTGG + Intergenic
1189241281 X:39526531-39526553 GAGGGACAGGAAGTTGGCAGTGG - Intergenic
1191184812 X:57598557-57598579 CAGGACTAGGATGGTGTCAGTGG + Intergenic
1194941700 X:100017765-100017787 CTGGCAAATAATGTTGTCAGGGG + Intergenic
1195165283 X:102214092-102214114 CAGGCACAGGAGGATATGAGGGG - Intergenic
1195193575 X:102472999-102473021 CAGGCACAGGAGGATATGAGGGG + Intergenic
1197127150 X:122959974-122959996 CAGACACTGGAACTTGTCAGAGG + Intergenic
1197309284 X:124884047-124884069 GAGCCACAGGTTGTTTTCAGTGG + Intronic