ID: 921124735

View in Genome Browser
Species Human (GRCh38)
Location 1:212167344-212167366
Sequence GAATATCCACAGAGGGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921124735_921124738 -3 Left 921124735 1:212167344-212167366 CCTTCATCCCTCTGTGGATATTC No data
Right 921124738 1:212167364-212167386 TTCAGACTCCCGCCTCTCAGTGG No data
921124735_921124742 10 Left 921124735 1:212167344-212167366 CCTTCATCCCTCTGTGGATATTC No data
Right 921124742 1:212167377-212167399 CTCTCAGTGGACAGCCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921124735 Original CRISPR GAATATCCACAGAGGGATGA AGG (reversed) Intergenic
No off target data available for this crispr