ID: 921130816

View in Genome Browser
Species Human (GRCh38)
Location 1:212218080-212218102
Sequence TTTCTAAGCACACTAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921130816_921130817 25 Left 921130816 1:212218080-212218102 CCAGCTTCTAGTGTGCTTAGAAA No data
Right 921130817 1:212218128-212218150 AGTATGCTCATTTTCAACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921130816 Original CRISPR TTTCTAAGCACACTAGAAGC TGG (reversed) Intergenic
No off target data available for this crispr