ID: 921133041

View in Genome Browser
Species Human (GRCh38)
Location 1:212236137-212236159
Sequence GCCTAGGGAAGCTGCAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921133041_921133052 12 Left 921133041 1:212236137-212236159 CCAGGCCTGCAGCTTCCCTAGGC No data
Right 921133052 1:212236172-212236194 CCTGGGCATCCTCCTTGGTGAGG No data
921133041_921133049 7 Left 921133041 1:212236137-212236159 CCAGGCCTGCAGCTTCCCTAGGC No data
Right 921133049 1:212236167-212236189 CCTTCCCTGGGCATCCTCCTTGG No data
921133041_921133056 30 Left 921133041 1:212236137-212236159 CCAGGCCTGCAGCTTCCCTAGGC No data
Right 921133056 1:212236190-212236212 TGAGGTTTCTGGATCCCTGCAGG No data
921133041_921133053 19 Left 921133041 1:212236137-212236159 CCAGGCCTGCAGCTTCCCTAGGC No data
Right 921133053 1:212236179-212236201 ATCCTCCTTGGTGAGGTTTCTGG No data
921133041_921133045 -6 Left 921133041 1:212236137-212236159 CCAGGCCTGCAGCTTCCCTAGGC No data
Right 921133045 1:212236154-212236176 CTAGGCCTCAGTTCCTTCCCTGG No data
921133041_921133046 -5 Left 921133041 1:212236137-212236159 CCAGGCCTGCAGCTTCCCTAGGC No data
Right 921133046 1:212236155-212236177 TAGGCCTCAGTTCCTTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921133041 Original CRISPR GCCTAGGGAAGCTGCAGGCC TGG (reversed) Intergenic
No off target data available for this crispr