ID: 921140927

View in Genome Browser
Species Human (GRCh38)
Location 1:212305438-212305460
Sequence TGTGGTCTGGTCTTTCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921140927 Original CRISPR TGTGGTCTGGTCTTTCCTGG TGG Intronic
900165809 1:1243889-1243911 TGTGGTCCCGTCTTGCCTGTGGG + Intronic
900385689 1:2409579-2409601 TGAGGTCTGGTCTTAGCTAGTGG + Intronic
900490158 1:2944039-2944061 TGGGGTCTGTTCTTTTCTGGGGG - Intergenic
900682532 1:3924762-3924784 TGTGGTCTGCTCTTTCAGGGGGG + Intergenic
903531824 1:24036808-24036830 TGTGTTTTGGTATTTCCTTGTGG + Intergenic
903600683 1:24536682-24536704 TGCGTTCTGTTCCTTCCTGGTGG - Exonic
905571103 1:39006441-39006463 GGTGGTTTGGTCTTACCTTGTGG - Intergenic
905955908 1:41995874-41995896 TGTGGTTTGGCCTCTGCTGGAGG - Intronic
907929955 1:58990205-58990227 TATGGTCTGAGCATTCCTGGTGG - Intergenic
908823218 1:68109084-68109106 TGTGTTCAGGTCTTTGTTGGGGG - Intronic
910044412 1:82894275-82894297 TTTGGTGTGGTATATCCTGGGGG + Intergenic
910661180 1:89674664-89674686 TGTTGATTGGTCTTTCCTGTTGG - Intronic
912511026 1:110190223-110190245 TGGGTTCTGGGCTTTCTTGGTGG + Intronic
916655527 1:166872248-166872270 TTTGGTGTTATCTTTCCTGGTGG + Intronic
917683629 1:177393687-177393709 TGTCTTCTGGGCCTTCCTGGAGG + Intergenic
917724329 1:177814552-177814574 TCTGGCCTTGCCTTTCCTGGTGG + Intergenic
920695936 1:208181324-208181346 TGTTCTCTGGTCTTTCCTTCAGG + Intronic
921140927 1:212305438-212305460 TGTGGTCTGGTCTTTCCTGGTGG + Intronic
921394957 1:214658864-214658886 TATGGGCTAGTCTTTCCTGTCGG - Exonic
924006219 1:239614564-239614586 GGTTGTCAGGTCTTTCTTGGAGG + Intronic
1062838180 10:650138-650160 TGGGGTCTTCTCTCTCCTGGGGG - Exonic
1064266163 10:13827317-13827339 TGTGTGCTGGGCTTTGCTGGGGG - Intronic
1064351384 10:14580454-14580476 TGTGGTTTTGAGTTTCCTGGGGG + Intronic
1067107748 10:43377023-43377045 TGTTCTCTGGCCTTTGCTGGAGG - Intergenic
1068910993 10:62378156-62378178 TGGTTTCTGGTGTTTCCTGGTGG + Intronic
1070154676 10:73826056-73826078 TGTGGCCTACTCTGTCCTGGGGG - Intronic
1070739368 10:78892595-78892617 TGTAGAGTGGGCTTTCCTGGGGG + Intergenic
1074507300 10:114082866-114082888 TGTGGGCTGGGCTTACCTAGTGG + Intergenic
1075944721 10:126422717-126422739 TGTGAGCTGGTCTTTCCTCTGGG - Intergenic
1076187104 10:128458568-128458590 TGTTGTCTGTACTCTCCTGGGGG - Intergenic
1076769333 10:132654485-132654507 AGTGGCCTGGTCTTTGCTGGGGG + Intronic
1078605960 11:12775949-12775971 TGTGGTGTGGTGTTTACTGGCGG + Intronic
1082000719 11:47392617-47392639 TGTAGTCTGGTCTCTCCCTGGGG + Intergenic
1084352724 11:68614881-68614903 TATGCTCTGGTCTCGCCTGGTGG + Exonic
1086920441 11:92580770-92580792 TGTGGTCTGGCCTTCTCTTGGGG + Intronic
1088146573 11:106687653-106687675 TGGGATCTGCTATTTCCTGGAGG - Exonic
1088755610 11:112882883-112882905 TAAGGGCTGGTCTTTCCTAGAGG + Intergenic
1088832440 11:113548890-113548912 TGTGGTTTTGATTTTCCTGGTGG - Intergenic
1089809148 11:121117369-121117391 TGTGATCTAGTCCTTGCTGGGGG - Intronic
1092021293 12:5204526-5204548 TGTGGTTTTGTCTTTCATGCAGG - Intergenic
1099004709 12:77222438-77222460 TGTACTCTGGTCTTTCCTATAGG + Intergenic
1101673547 12:106897977-106897999 TGTGGTCTGGTCTTTCAGGATGG - Intergenic
1102632978 12:114298549-114298571 TGGGGGCTGGTCTGTTCTGGAGG - Intergenic
1102633068 12:114299144-114299166 TGGGGGCTGGTCTGTTCTGGAGG - Intergenic
1104672766 12:130691861-130691883 TGTGGACTGTGCTTTCCTTGTGG + Intronic
1104675718 12:130710666-130710688 TGTGGACAGGTCCTTCCTGTTGG - Intronic
1104686539 12:130788607-130788629 TATGGTCTGTTCTTTCCTTTAGG + Intergenic
1105010057 12:132749629-132749651 AGTTGTCTGGGCTTCCCTGGCGG - Intronic
1109172262 13:59111668-59111690 TGTAGTCTGTACATTCCTGGGGG - Intergenic
1110240174 13:73258166-73258188 TGTGGTCCGTCCTTGCCTGGAGG + Intergenic
1112257133 13:97844372-97844394 TCTGGTCTGGGGTTTCCTGGAGG - Intergenic
1112667416 13:101591654-101591676 AATGGTCTAGTCTTTACTGGAGG + Intronic
1115157613 14:30358532-30358554 TGGTGTCTGGTCTGGCCTGGAGG - Intergenic
1116981003 14:51170253-51170275 TGTCCTCTGGTATTTCCTGAAGG + Intergenic
1120916497 14:89715165-89715187 CCTGGTCTGGTCTTTCCAAGAGG + Intergenic
1122070801 14:99204261-99204283 TGTGGACTCGTCTTTCCAGGGGG + Intronic
1122793928 14:104196325-104196347 TGTGTACAGGTCTTTCATGGCGG + Intergenic
1122870864 14:104638010-104638032 TGAAGTCTGATGTTTCCTGGGGG - Intergenic
1123933047 15:25181105-25181127 CGTGGCCTGGTCAGTCCTGGAGG - Intergenic
1124806541 15:32889544-32889566 TGTGGTCTGTTATTTCATGAAGG - Intronic
1125179176 15:36862023-36862045 TCTGCTCTGTTCTTTGCTGGTGG + Intergenic
1125455252 15:39852093-39852115 TCTGGTCTAGTGTTTCCTGCTGG + Intronic
1125664657 15:41420723-41420745 TCTAGGCTGGTTTTTCCTGGTGG + Intronic
1127435841 15:58957414-58957436 TGGCGTCTGGTCTTCCCTAGAGG + Intronic
1127662747 15:61115484-61115506 TGTGCTCTTGGCTTTCCTTGAGG - Intronic
1130810071 15:87367785-87367807 GATGGTCTGGTCTTTCTCGGTGG - Intergenic
1130904238 15:88228606-88228628 TGTGCTGTGGGTTTTCCTGGAGG - Intronic
1131040001 15:89255615-89255637 TGTTGTCTGATGTTTCCTTGTGG - Intronic
1137945309 16:52728414-52728436 AGTGCTTTGCTCTTTCCTGGGGG + Intergenic
1138250070 16:55495255-55495277 TGTGGTCAGGGCTTTCTTAGTGG - Intronic
1138546078 16:57720633-57720655 CGGGGTCTGGTTTTTCCTGGGGG - Intronic
1139678905 16:68544661-68544683 AGTGGTCTGGTTTCCCCTGGTGG - Intronic
1140117036 16:72050955-72050977 TGTGGGCTGGGCTTAGCTGGAGG + Intronic
1141933227 16:87218517-87218539 GGGGGTCAGGTCTGTCCTGGGGG - Intronic
1141933271 16:87218663-87218685 TGGGGTCAGGTCTGTGCTGGGGG - Intronic
1142964696 17:3573294-3573316 TGTGGTCTGGGTGGTCCTGGAGG - Intronic
1143016817 17:3895245-3895267 TGTGGACTGGTCTTTCTGGAAGG + Intergenic
1146353302 17:32113799-32113821 TGTGATCTGCTCTAGCCTGGGGG + Intergenic
1147360427 17:39926783-39926805 TGAGGGCTGCTCTTTCCTGGGGG - Exonic
1148772921 17:50077229-50077251 TCTGGTCTGGGCCTTCTTGGGGG + Intronic
1148863585 17:50617419-50617441 TGTATTCTGGGCTTTCCAGGTGG + Exonic
1150214639 17:63459841-63459863 TGGGGTCTCTTCCTTCCTGGTGG + Intergenic
1150431925 17:65125286-65125308 TGCGGGGTGGTCTTTCCTGAAGG - Intergenic
1152035146 17:77867702-77867724 TGTGGTCTGGGCCTTTCTCGAGG + Intergenic
1152063010 17:78093118-78093140 TGTTGCATGGTCTTACCTGGGGG - Exonic
1152066177 17:78113621-78113643 TGTGTTCTGGCCTTTCTAGGAGG - Exonic
1152305076 17:79515573-79515595 TCTGCTCTGCTCTTTCCTTGAGG + Intronic
1152728421 17:81958831-81958853 TCTGAAATGGTCTTTCCTGGGGG - Intronic
1152733190 17:81983532-81983554 TGTGCTCTGGTCTGTCTTGCAGG + Exonic
1152930792 17:83108614-83108636 AGGGGTCTGGTCTGTCCTGAAGG - Intergenic
1156346468 18:36261150-36261172 TGTGCTCTGTTCTTTAGTGGGGG + Intronic
1157358042 18:46953273-46953295 TGTGGTTTTGTCTTTCATGTGGG + Intronic
1157404446 18:47411301-47411323 TGTGGTCTTATCTATCCTGGAGG + Intergenic
1160805335 19:990051-990073 TGGGGTCTGGTTTGTTCTGGGGG + Intronic
1164675161 19:30095805-30095827 TGTGCTCTGCTGTTCCCTGGAGG - Intergenic
1166204722 19:41262324-41262346 GGTGGGCTGGTCTTCGCTGGAGG - Intergenic
1166864728 19:45828977-45828999 TCTGGTCTGGTTTCTCCTGCAGG + Exonic
1167673897 19:50872975-50872997 TGTGGTCTCAGCTATCCTGGAGG + Intronic
1168062981 19:53904483-53904505 TTTGGTCTGATCTCTCCTGAGGG + Intronic
926043043 2:9690206-9690228 GTTGGTGAGGTCTTTCCTGGTGG + Intergenic
927397423 2:22669928-22669950 TGCAGTCTGGCCTTTCCTGGTGG + Intergenic
928900226 2:36309608-36309630 GGTGGTCTGGCCTTTCCCTGTGG - Intergenic
929877285 2:45807353-45807375 TGTCTTCTGGTCTTTGCTGATGG + Intronic
931805436 2:65799231-65799253 TGTGTGCTGTTCTTTTCTGGTGG + Intergenic
934952497 2:98586936-98586958 TCTGGTCTGCTGTCTCCTGGAGG - Intronic
942433128 2:175937460-175937482 TGAGGTCTGGTTTTTCTTGCAGG + Exonic
943849554 2:192700182-192700204 TGTGGTTTGGTGTTTGCTTGTGG + Intergenic
945635730 2:212347847-212347869 AGTGGTCTGGTCTTTTAAGGGGG + Intronic
946014122 2:216590279-216590301 TGTGGCATTGTCTTTCCTGGGGG + Intergenic
948531421 2:238608982-238609004 TATGATATGGTCTGTCCTGGAGG - Intergenic
1168931786 20:1630148-1630170 TGTGGGCTGGGCCTTCCTGTTGG + Intronic
1169472118 20:5895517-5895539 TCTGATCTGGGCCTTCCTGGTGG - Intergenic
1172098123 20:32470555-32470577 TGTGGTCTGGCGTTGCCTTGGGG - Intronic
1174211536 20:48882782-48882804 TGTGGACTGGTATTTCATTGTGG + Intergenic
1176369261 21:6052661-6052683 TGTGAACTGGGCTTTCCTCGTGG + Intergenic
1179754258 21:43485880-43485902 TGTGAACTGGGCTTTCCTCGTGG - Intergenic
1179947685 21:44689044-44689066 TGTGGTCTGTTTTCTGCTGGAGG - Intronic
1181279392 22:21708219-21708241 CGAGGTCTGATCCTTCCTGGTGG + Intronic
1181655169 22:24291654-24291676 TGTTATCTGGTCTTTACTGTGGG + Intronic
1185137167 22:49079639-49079661 TGTGGTGGGGACTTGCCTGGCGG + Intergenic
1185148273 22:49150794-49150816 GATGGCCTGGTCTCTCCTGGTGG - Intergenic
1185343890 22:50303110-50303132 TGTGGGGGGGTCTCTCCTGGGGG - Intronic
950095865 3:10330003-10330025 TGGGGTCTCTTATTTCCTGGGGG + Intronic
950526428 3:13526785-13526807 GGTGGTCTGGTGTCTCCAGGTGG + Intergenic
950569990 3:13793792-13793814 TGTGGCCTCTGCTTTCCTGGGGG + Intergenic
950889465 3:16390242-16390264 TGCAGTCTGGTATTTCCTGTGGG - Intronic
951036123 3:17934104-17934126 TGTGGCTTGGTTTTTCCTTGGGG + Intronic
952964118 3:38610533-38610555 TGTGGTCAGGTGTGTGCTGGGGG + Intronic
956798030 3:72733494-72733516 TATGGTCTAGTCTCCCCTGGAGG + Intergenic
957581272 3:82076631-82076653 TGTGAAATGGTCTTTCCTTGGGG - Intergenic
958873062 3:99584021-99584043 TGTGGACTGGCCTTTCAAGGTGG + Intergenic
961388114 3:126535954-126535976 GGTGATCTGGCCTTTCCTAGAGG + Intronic
965486602 3:169285783-169285805 TGTGCTATGGTGTTTCCTTGGGG + Intronic
965781479 3:172290483-172290505 TGTGGTCTGACCTTCTCTGGTGG + Intronic
968960059 4:3738950-3738972 GGAGGTCAGGTCTTCCCTGGGGG + Intergenic
973034741 4:45391334-45391356 GATGGTCTGGTCTCTCTTGGTGG + Intergenic
976138961 4:81970497-81970519 TGTGCTCTGGACTTTCCTCCTGG - Intronic
978843040 4:113237099-113237121 TTTGGTGTCGTCTTTCCTAGCGG - Exonic
983428541 4:167619153-167619175 TAAGGTATGGTCTATCCTGGAGG + Intergenic
983575792 4:169260396-169260418 TGTGGTCTGTTCTTTCCAAGTGG - Intronic
985082616 4:186281585-186281607 TGTGGTGTGTTCTTTCCTGTTGG - Intronic
985415011 4:189727039-189727061 TGGGGTCTGTTCTTTACTGTGGG - Intergenic
985524175 5:393562-393584 GTGGGTCTGCTCTTTCCTGGAGG + Intronic
986495724 5:8340023-8340045 GGTGGTTTAGTCTCTCCTGGTGG - Intergenic
987210702 5:15679256-15679278 TTTGGTCTTGTCTTTCAGGGAGG - Intronic
987231313 5:15896555-15896577 TGTGATCTGGGCTTTCCAGCTGG - Intronic
988485525 5:31665401-31665423 TGTGTTCTGGTCTTTTATGGAGG + Intronic
992420205 5:76596334-76596356 TCTGATTTGCTCTTTCCTGGTGG + Intronic
992564971 5:77987476-77987498 TGTAGTCTGGTCACTCCTTGGGG - Intergenic
998409693 5:141900122-141900144 GGTGGTCTGGTATCTCCTCGGGG + Intergenic
998902365 5:146869929-146869951 TGTGGTAGGGTCCTTCCTGGTGG + Intronic
999502947 5:152165042-152165064 TGTGCTCTGCTCTCCCCTGGTGG + Intergenic
1000233578 5:159337213-159337235 TTAGGTGTGGTATTTCCTGGAGG + Intergenic
1003123299 6:3335659-3335681 TGGGGGCTCTTCTTTCCTGGGGG + Intronic
1004325217 6:14668537-14668559 TGTGAGCTGGTGTTTCCTGAAGG + Intergenic
1004598860 6:17128305-17128327 TCTGTTCTGGGCTTTGCTGGAGG - Intronic
1005422605 6:25668477-25668499 TGTGGTCTTGTCTCTGATGGAGG - Intronic
1007113796 6:39329119-39329141 TGTGGTTTTGTCATTCCTGCAGG + Intergenic
1007267535 6:40608521-40608543 TCTGGTCTGATTTTTCCAGGAGG - Intergenic
1007505753 6:42333966-42333988 TGTGGTCTTTTTTTTCCTAGTGG - Intronic
1007768818 6:44177321-44177343 TGTGGTCTGCACCTGCCTGGTGG + Exonic
1008342708 6:50387233-50387255 CATATTCTGGTCTTTCCTGGGGG + Intergenic
1009208343 6:60832285-60832307 GGTGGTCTGGTCTCTCTTAGTGG - Intergenic
1009512256 6:64568198-64568220 TTGGGTCTGTTCTTTTCTGGTGG - Intronic
1009694876 6:67089270-67089292 CATGGTCTGGTCTCTCCTGATGG + Intergenic
1010090749 6:71978003-71978025 GGTGGTCTGGACTCTACTGGTGG + Intronic
1010655193 6:78503439-78503461 GATGGTCTGGTCTCTCTTGGTGG + Intergenic
1011716502 6:90111191-90111213 TGTGGTCTGTGGGTTCCTGGGGG - Intronic
1013611171 6:111796925-111796947 TGTGGTCATGTCTTATCTGGAGG + Intronic
1015473316 6:133631420-133631442 TCTGAGCTGGTCTTTCCTGGTGG - Intergenic
1019555271 7:1626177-1626199 TGTGGTCTGGCCGGGCCTGGTGG + Intergenic
1019702869 7:2482514-2482536 TGGGCTCTGTCCTTTCCTGGGGG - Intergenic
1019759558 7:2800378-2800400 TGTGGTCTGGACTGTGGTGGTGG + Intronic
1020411910 7:7901816-7901838 AATGGTTTGGTCTTTCCTGTAGG - Intronic
1021200589 7:17724798-17724820 TGTGGTTTGGTGTTCCTTGGAGG + Intergenic
1023535596 7:41205719-41205741 TGTGGTCTGGGGATTTCTGGGGG + Intergenic
1023987295 7:45104256-45104278 TGTGATCTGCTCTGTCCTGAAGG - Exonic
1026972368 7:74476194-74476216 TGTGGGCTGGTGGTGCCTGGTGG + Intronic
1027559175 7:79705726-79705748 TTTGTTCTTGTTTTTCCTGGTGG - Intergenic
1033222740 7:139539583-139539605 TGTGTCCCGGTCTGTCCTGGTGG + Intronic
1034448399 7:151124973-151124995 TGTGCTCTTGGCTTTCCAGGGGG - Intronic
1037320192 8:17634144-17634166 TGTGCTCTGCACTGTCCTGGGGG + Exonic
1038646454 8:29366028-29366050 GGTGGTCAGGACTTTCCTCGGGG + Intergenic
1038683966 8:29698337-29698359 TTTGGTTTGGTCTTTCTTTGAGG - Intergenic
1040639239 8:49313211-49313233 AGTGTTCTGGTCTTTCTGGGAGG + Intergenic
1041345728 8:56895783-56895805 TGTGGTTTGTTGTTTGCTGGAGG + Intergenic
1042861175 8:73315605-73315627 CGTGCTCTGGTCTTGCCTGCAGG - Intronic
1044866071 8:96572383-96572405 TGTGCACTGGTCTTTTGTGGAGG + Intronic
1048290837 8:133180675-133180697 TGTCCTCTGGACCTTCCTGGGGG - Intergenic
1048759671 8:137779646-137779668 TGTGGTTTTGTTTTTCTTGGTGG - Intergenic
1049313940 8:141949031-141949053 TTTGGTCTTGTCTATGCTGGAGG - Intergenic
1049787766 8:144459233-144459255 GGTGGTCAGGTCGTTCCTGCCGG - Intronic
1051209095 9:14722614-14722636 TGCCGTGTGGTCTTTCCTAGAGG + Exonic
1051527932 9:18068071-18068093 TTTGGTCTGGTCCTGCCCGGAGG + Intergenic
1052906435 9:33838793-33838815 TGTGGTCTGGCCAGTCGTGGTGG + Intronic
1053582267 9:39417722-39417744 TGAGGTCAAGTCTTTGCTGGGGG + Intergenic
1054103845 9:60976461-60976483 TGAGGTCAAGTCTTTGCTGGGGG + Intergenic
1054282544 9:63138446-63138468 TGGGGTCCTCTCTTTCCTGGAGG + Intergenic
1054582506 9:66930386-66930408 TGAGGTCAAGTCTTTGCTGGGGG - Intronic
1054918102 9:70514398-70514420 GGTGGCCTGTTCCTTCCTGGAGG + Intergenic
1057055466 9:91957100-91957122 TGTGGTCAGGTTTTTCCTGATGG + Intergenic
1058282902 9:103139428-103139450 TGTGCTCTTGTGTTTCTTGGTGG + Intergenic
1060082375 9:120661845-120661867 AGTGTTCTGGTCATTTCTGGTGG - Intronic
1061230646 9:129313831-129313853 TGTGGTCTGAGCTAACCTGGTGG - Intergenic
1061522503 9:131127620-131127642 TATGGTCTGGTCTTCGCTGGTGG + Exonic
1062340115 9:136090414-136090436 AGTGGGCTGGTGTTTTCTGGAGG - Intronic
1189866154 X:45329374-45329396 TGTGGTTTGGCATTTCCTGGTGG + Intergenic
1193809843 X:86038391-86038413 AGTTGTCTGGCCTTTCCTGATGG + Intronic
1201302117 Y:12517481-12517503 TGTGGTCAAGTCTTTACTGTTGG - Intergenic
1201340332 Y:12926267-12926289 TGTGATCTGATTTTTCCTGTGGG - Intergenic
1201575806 Y:15460272-15460294 TGTGTCCTGGTCTTTCCTGCAGG + Intergenic