ID: 921146263

View in Genome Browser
Species Human (GRCh38)
Location 1:212360778-212360800
Sequence GCCTCCCACCTCTGCCGGAT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921146261_921146263 -8 Left 921146261 1:212360763-212360785 CCGAATAAAAAAAAAGCCTCCCA 0: 1
1: 0
2: 6
3: 68
4: 687
Right 921146263 1:212360778-212360800 GCCTCCCACCTCTGCCGGATAGG 0: 1
1: 0
2: 0
3: 8
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921146263 Original CRISPR GCCTCCCACCTCTGCCGGAT AGG Exonic
900251754 1:1674507-1674529 TCCTCCCACCTCAGCCTGTTGGG - Intronic
900262162 1:1737363-1737385 TCCTCCCACCTCAGCCTGTTGGG - Intronic
900410724 1:2511303-2511325 GCCTCCCACCTCTGCTGCTGGGG - Intronic
900727989 1:4231010-4231032 TCCTCCCACCTCTGCCTCCTGGG + Intergenic
901197897 1:7450446-7450468 TCCACCCACCTCTGCTGGAGGGG + Intronic
901401128 1:9015683-9015705 GCCTCCCACCCCTGCTGGTATGG + Intronic
902071346 1:13741484-13741506 CCCTGCCACCTCTGCCAGAAAGG + Intronic
903390479 1:22960211-22960233 GCCTCCCAGCTATGCCCCATGGG + Intronic
903617812 1:24674935-24674957 ACCTCCCACCTCAGCCTCATGGG - Intergenic
903675448 1:25061825-25061847 GGCTCCCACGCGTGCCGGATGGG + Intergenic
903715334 1:25361628-25361650 GCTCCCCACCTCTGCAAGATGGG + Exonic
906153241 1:43599935-43599957 GCCTCTCACCTCTGCCTGGGTGG + Intronic
907176879 1:52532432-52532454 GCCTCCCACCTCAGCCTCACAGG + Intronic
911055897 1:93708303-93708325 GCCTCCGGCCTCTGGCAGATGGG + Intronic
912456695 1:109802896-109802918 GCCTCCCACAGCTGCAGGATTGG + Intergenic
912908539 1:113733002-113733024 TCCTCCCACCTCAGCCTCATAGG + Intronic
915594731 1:156889915-156889937 GCCCCCCAGCTCTGCCTGCTGGG - Intergenic
919807176 1:201387017-201387039 GCCTCCAGCCTCTCCTGGATGGG + Exonic
921146263 1:212360778-212360800 GCCTCCCACCTCTGCCGGATAGG + Exonic
921715027 1:218408961-218408983 GTCTCCCATCACTGCCAGATGGG - Intronic
1064823433 10:19366231-19366253 GCCTCCCATCACCCCCGGATGGG - Intronic
1067851457 10:49757399-49757421 GTCTCCCACCAGTGCCGTATGGG - Intronic
1068083310 10:52346672-52346694 GCCTCCCACCACTGCCGTGAGGG + Intergenic
1069521549 10:69124963-69124985 CCCTCCCTCCTCTGCCTCATAGG - Intronic
1074522601 10:114239385-114239407 TCCTCCGACCTCAGCCGGGTCGG + Exonic
1074575873 10:114668578-114668600 TCCTCCCACCTAAGCCGTATAGG + Intronic
1076116518 10:127905526-127905548 GCCTCTCACCCCTGCCCGCTGGG - Intergenic
1076788602 10:132764533-132764555 CCCTCCCACCCCTGCAGGACTGG - Intronic
1076788617 10:132764584-132764606 CCCTCCCACCCCTGCAGGACTGG - Intronic
1076788630 10:132764635-132764657 CCCTCCCACCCCTGCAGGACTGG - Intronic
1076788688 10:132764910-132764932 CCCTCCCACCCCTGCAGGACTGG - Intronic
1076788714 10:132765020-132765042 CCCTCCCACCCCTGCAGGACTGG - Intronic
1076788738 10:132765130-132765152 CCCTCCCACCCCTGCAGGACTGG - Intronic
1080632664 11:34093370-34093392 TCCTCCCACCTCTACCTTATAGG + Intronic
1081844323 11:46228169-46228191 GCCTCCCACCTCAGCCTCCTGGG - Intergenic
1083759366 11:64807278-64807300 GACCCCCACCTCTGCCCGATAGG - Intronic
1085699836 11:78736058-78736080 TCCTCCCACCTCTGCCTCCTGGG + Intronic
1087509853 11:99077867-99077889 GACTCACAGTTCTGCCGGATAGG - Intronic
1089221435 11:116875259-116875281 TCCCTCCACCTCAGCCGGATGGG - Exonic
1090617677 11:128530646-128530668 TCCTCCCACCCCTCCTGGATGGG - Intronic
1091212006 11:133869936-133869958 TCCTCCCACCTCAGCCTGCTGGG + Intergenic
1092912352 12:13157943-13157965 TCCTCCCACCTCAGCCTCATGGG + Intergenic
1094705720 12:32912606-32912628 GCCTCCCAGCGCTGCCACATTGG + Intergenic
1098102648 12:67034872-67034894 GCATTCCACCTTTGCCGGTTTGG + Intergenic
1099776387 12:87136926-87136948 GCCTCCCAACACTGCCACATTGG + Intergenic
1103687840 12:122746237-122746259 TCCTCCCACCTCAGCCTGCTGGG - Intergenic
1104961256 12:132489682-132489704 GCCGCCCTCCTCTGCGGGACTGG - Exonic
1111766462 13:92536460-92536482 CCCTCTCACCTCTCCTGGATTGG + Intronic
1113924066 13:113930594-113930616 TCCTTCCAGCTCTGCTGGATTGG - Intergenic
1113978297 13:114249133-114249155 GTCTCCCATCTCTCCCAGATGGG - Intronic
1117920621 14:60723042-60723064 GCCCCCTACCTCTGCCGGCCGGG + Intronic
1119574939 14:75711636-75711658 TCTTCCCACCTCCGCCGCATGGG - Intronic
1120167893 14:81220335-81220357 GCTTCCCGCCTCGGGCGGATCGG - Intronic
1120941907 14:89957049-89957071 CTTTCCCACCTCTGCCGGCTGGG + Intronic
1120969163 14:90192957-90192979 GCCTCCCACCTCAGCCTCCTGGG - Intergenic
1122597458 14:102903309-102903331 TCCTCCCAGTTCTGCCGGAAGGG - Exonic
1122627268 14:103090989-103091011 ACCTCCCACCTTTCCCGCATTGG - Intergenic
1124346088 15:28922461-28922483 TGCTCCCACCTCTGCAGGAGGGG - Intronic
1127846686 15:62876799-62876821 GCCTCCTACCACTGCAGAATTGG - Intergenic
1128998714 15:72316062-72316084 GCCTCCCACCTCTGGAGGGAGGG + Intronic
1129318321 15:74759646-74759668 GAATCCCACCTCTGCCTGGTAGG + Intergenic
1129428442 15:75481373-75481395 ACCCCCCACCTCCTCCGGATGGG - Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1134183113 16:12063312-12063334 GCCTCCCTCCACTTCCTGATGGG + Intronic
1135039608 16:19107999-19108021 ACCTCCCACCTCAGCCTCATGGG + Intergenic
1135105119 16:19642621-19642643 GCCTCCTTCCTCTCCTGGATTGG - Intronic
1135352389 16:21739950-21739972 TCCTCCCACCTCAGCCTGCTGGG + Intronic
1135450877 16:22556072-22556094 TCCTCCCACCTCAGCCTGCTGGG + Intergenic
1137586731 16:49668301-49668323 GCCTCCCACCCCTGCCATTTCGG - Intronic
1137600823 16:49755050-49755072 GCCTCCCTCCTCAGCAGGAGGGG + Intronic
1139837104 16:69847834-69847856 ACCTCCCAACTCTGCCACATTGG + Intronic
1140379314 16:74472010-74472032 TCCTCCCACCTCTGCCCCCTAGG + Intronic
1140616174 16:76667192-76667214 TCCTCCCACCTCAGCCTGTTGGG + Intergenic
1140868106 16:79081842-79081864 TCCTCCCACCTCTGTGGGTTAGG + Intronic
1141499018 16:84430906-84430928 CCCCCCCACCTCAGCAGGATGGG + Intronic
1143107005 17:4535013-4535035 GCCCCCCACCTCTCCCGCAACGG + Intronic
1143519283 17:7436439-7436461 TCCTGCCACATCTCCCGGATGGG - Exonic
1143796841 17:9343766-9343788 GCCCTCCCCATCTGCCGGATAGG + Intronic
1146656710 17:34638885-34638907 GACTCCCACCTCTGCCCCAAGGG + Exonic
1147445782 17:40474536-40474558 CCCTCCCACCCCTGCCGGGCTGG + Intergenic
1148019853 17:44546542-44546564 GCTTCCAACCTCTGCAGTATAGG + Intergenic
1148553592 17:48564741-48564763 CCCTCCCTTCTCTGCCGGGTCGG - Intronic
1151029796 17:70723331-70723353 GCCTCCTACCTCTGCCAGGTGGG - Intergenic
1152069120 17:78126435-78126457 GCCTCCCAGCTCTGCAGGCCTGG - Intronic
1152277277 17:79365265-79365287 CCCTCCCACTTCTGCTGGAGTGG - Intronic
1153989954 18:10387615-10387637 GCCTGCTACCTCTGACAGATGGG - Intergenic
1157501069 18:48191127-48191149 CCCTCCCACCTCTGCAAGGTGGG - Intronic
1157751609 18:50183729-50183751 GCCTCCCACCCCCGCCACATTGG - Intronic
1158708545 18:59816780-59816802 TCCTCCCACCTCGGCCTCATGGG - Intergenic
1160887339 19:1356002-1356024 GCCTCCGACCTCGGCAGGAGAGG - Intronic
1162431009 19:10628443-10628465 TCCTCCCACCTCAGCCTGCTGGG - Intronic
1162551616 19:11361337-11361359 GCCTGCCACCTTCTCCGGATCGG + Exonic
1163190703 19:15674782-15674804 TCCTCCCACCTCAGCCTGCTTGG + Intronic
1166375663 19:42325650-42325672 GCCTCCCTCCGAAGCCGGATGGG - Intronic
928722151 2:34133144-34133166 GCCCCCCACCTCCCCCGGACGGG + Intergenic
930665523 2:54095962-54095984 CCCCCCCACCTCCTCCGGATGGG + Intronic
931739370 2:65228082-65228104 GCCTCCCACCTCCGCGGGCGTGG + Intronic
932785970 2:74604178-74604200 CACTCCCACCTCTGCCTGACAGG + Intronic
934568396 2:95353098-95353120 GCCTCCCAGCTGGGCAGGATTGG + Intronic
934681124 2:96284585-96284607 GCCTCCCTCCTCTGCCCGCCAGG - Exonic
937964602 2:127493332-127493354 GGCTCTCACCTCTACCAGATAGG - Exonic
940990714 2:160093299-160093321 GTCTCCCATCACTGCCAGATGGG - Intergenic
944582475 2:201143884-201143906 GCCTGCAACCTCTGCCGCCTGGG - Intronic
949070156 2:242019572-242019594 GTCTCTCCCCTCTGCCGGACAGG - Intergenic
1169720522 20:8671541-8671563 TCCTCACGCCTCTGCCAGATGGG + Intronic
1173844226 20:46177908-46177930 GCCACCCAGCCCTGCCTGATTGG - Intronic
1174021355 20:47532573-47532595 GGCTCCCACCTCAGCCTCATGGG + Intronic
1174218793 20:48936255-48936277 CCCCCCCACCCCTGCCGGACGGG + Intronic
1174488656 20:50876925-50876947 GCCTCCCACATCGGCCTGCTTGG + Exonic
1175272812 20:57746837-57746859 TCCTCCTACCTTTGCCTGATGGG + Intergenic
1175583243 20:60116744-60116766 GCCTCCAACCCCTGCCTGACGGG + Intergenic
1176302723 21:5106232-5106254 GGCTCCCGCCTCTGCCTGGTGGG - Intergenic
1177803700 21:25853493-25853515 GCCTCCCAACACTGCTGCATTGG + Intergenic
1179854301 21:44155691-44155713 GGCTCCCGCCTCTGCCTGGTGGG + Intergenic
1180131791 21:45831299-45831321 TCCTCCCACCTCAGCCTGCTAGG - Intronic
1183262787 22:36806655-36806677 GCCTCCCAGTTCTCCGGGATGGG - Intronic
1183337738 22:37260235-37260257 GTCTCCCATCACTCCCGGATGGG - Intergenic
1184378744 22:44131859-44131881 GCCTCTCTCCTCTGCAGCATGGG - Intronic
1184626191 22:45732349-45732371 GCCTCCCACCTCAGCCTCACCGG - Intronic
1185119691 22:48958577-48958599 GCCTCCCTCCTCTGGCTGCTGGG + Intergenic
949736323 3:7176141-7176163 TCCTCCCACCTCTGCCTTATAGG - Intronic
950206697 3:11086325-11086347 GCTTTCCACCTCTGCCACATTGG + Intergenic
953574040 3:44098472-44098494 CCCTCCCACCTCTACCCCATGGG + Intergenic
954254224 3:49392795-49392817 GTCTCCCACAGCTGCTGGATTGG + Intronic
954746094 3:52788355-52788377 GCATCACACCTCTGCCAGACAGG + Intronic
955927446 3:64022325-64022347 GCCGAGTACCTCTGCCGGATAGG - Exonic
960577185 3:119240960-119240982 GCCTCCCGCCTTGGCCGGAGAGG + Intronic
961455597 3:127022439-127022461 TCCTCCCACCCCTGCCCGGTGGG - Intronic
961471244 3:127114524-127114546 GCCACCCAGCTGTGCAGGATGGG - Intergenic
962555920 3:136551375-136551397 ACCTCCCACCTCTGCAAGCTAGG + Intronic
968322543 3:197783113-197783135 ACCTGCCACCTCTGACGGAGTGG + Exonic
968586468 4:1419003-1419025 GCCTCCCACATCTGCCGTGTTGG - Intergenic
969491127 4:7499834-7499856 TCCACCCACCTGTGCCGGCTCGG - Intronic
971196135 4:24472634-24472656 GCATCCCTCCTCTCCCGGAGAGG - Intergenic
976236468 4:82902214-82902236 TCCTCCCACCTCAGCCTCATGGG + Intronic
977226750 4:94401351-94401373 TCCTCCCACCTCAGCCCCATAGG + Intergenic
977626513 4:99194396-99194418 GCCTCCCGCCTCTGCCTCCTGGG + Intergenic
978149448 4:105415532-105415554 CCCACCCACCTCTGCAGGCTCGG - Intronic
978578818 4:110212489-110212511 GCCTCCCACCTAAGCCTGAGTGG - Intergenic
979693287 4:123583605-123583627 TCCTCCCACCTCAGCCGCTTAGG + Intergenic
979844384 4:125490113-125490135 GCCTCCCACCCGTGCCAGAATGG + Exonic
981725066 4:147838638-147838660 GCCTCCCACCTCAGCCTCCTGGG + Intronic
982930967 4:161407410-161407432 GCCTCCTCCCTCTTCAGGATCGG - Intronic
983992889 4:174143504-174143526 TCCTCACACCTCTATCGGATAGG + Intergenic
984227476 4:177052513-177052535 ATCTCCCACCTCAGCCCGATTGG + Intergenic
985542177 5:492288-492310 ACCTCCCTCCTCTGCCGCACGGG - Intronic
987692048 5:21279758-21279780 TCCTCCCACCTCAGCCTCATGGG - Intergenic
987794040 5:22605531-22605553 ACCTCCCACCTCTGAAGGTTGGG + Intronic
988095936 5:26610181-26610203 GCCTCCCATCACTCCCAGATGGG + Intergenic
988632330 5:32944604-32944626 GCCTCCCACCTCAGCCTCCTGGG + Intergenic
991687322 5:69193507-69193529 TCCTCCCACCTCAGCTGGGTGGG - Intronic
992854676 5:80848119-80848141 TCCTCCCACCTCAGCCTGCTGGG - Intronic
994081399 5:95711712-95711734 GCCTCAACCCTCTGCCGGTTCGG - Intergenic
995915155 5:117236630-117236652 GCCTCCCACCCCCTCCGGACAGG + Intergenic
996969263 5:129343894-129343916 GCCTCCAACCTATGACTGATGGG - Intergenic
997206178 5:132051523-132051545 TCCTGCAACCTCTGCCTGATGGG + Intergenic
1001371847 5:171212100-171212122 GCCTCCTACCTCTCCCTAATGGG - Intronic
1002415661 5:179119658-179119680 GCCCCCCACCTGAGCCGGATGGG + Intronic
1002550977 5:179991853-179991875 GTCTCCCATCTCTCCCAGATGGG - Intronic
1003919618 6:10821054-10821076 TCCTCCCACCTCTGCCTCCTGGG + Intronic
1005281494 6:24279259-24279281 TCCTCCCACCTCTGCCTCCTAGG - Intronic
1007069619 6:39026820-39026842 GCCTCCCCCATCTGCCAGAGTGG + Intronic
1007769111 6:44179404-44179426 TCCTCCCACCTCTGCAGCAGAGG + Intronic
1008745173 6:54661036-54661058 GCCTCCCACCTCTTCCCGACAGG - Intergenic
1010206003 6:73323062-73323084 CCCTCTCACATCTGCCAGATGGG - Intergenic
1010478357 6:76317869-76317891 TCCTCCCACCTCAGCCTCATAGG + Intergenic
1012228187 6:96729201-96729223 TCCTCCCACCTCTGCCTCCTGGG - Intergenic
1015729204 6:136331170-136331192 TCCTCCCACCTCAGCCTCATGGG - Intergenic
1015880791 6:137867994-137868016 GCCCCCCACCTCCGCCGGGCTGG - Intronic
1019205651 6:170359521-170359543 GCCTCCCACCTCAGCCTCCTGGG + Intronic
1019927526 7:4203112-4203134 GCCTCCTGCCTCTGCGGGAAGGG - Intronic
1020049041 7:5069945-5069967 GCCTCCCACCTCAGCCTCCTGGG + Intronic
1021021217 7:15600320-15600342 GCCCCCCACCTCAGCAGGTTTGG - Intergenic
1022376881 7:29822390-29822412 GCTACCCACCTCTACCGGCTGGG - Intronic
1029930623 7:104366653-104366675 GCCTCCCACTTCTATAGGATGGG + Intronic
1033724229 7:144095828-144095850 TCCTCCCACCTCTGCGTGGTGGG + Exonic
1033736973 7:144232101-144232123 TCCTCCCACCTCTGCGTGGTGGG - Exonic
1033746084 7:144318845-144318867 TCCTCCCACCTCTGCGTGGTGGG + Exonic
1033783710 7:144704128-144704150 GCCTCCCACCTTTGACACATGGG - Intronic
1034303585 7:150035209-150035231 GCCTCCCACCTCTGCCATGGGGG + Intergenic
1037371577 8:18184665-18184687 GCCTCCCACTACTGTTGGATGGG - Intronic
1038420310 8:27430279-27430301 CCCTCTCACCTCTTCCTGATTGG + Intronic
1039034303 8:33343029-33343051 GCCTGCAACCTCTGCCGCCTAGG - Intergenic
1039194949 8:35020532-35020554 GCATCCCACCTCTGTTGCATTGG + Intergenic
1039505635 8:38050455-38050477 TCCTCCCACCTCTGCCTCCTGGG + Intronic
1044950863 8:97434205-97434227 GCCTCCCACTGCTGCAGAATTGG + Intergenic
1045527650 8:102955167-102955189 GCCTCCAACCTCTGCCTTTTGGG + Intronic
1049400851 8:142426586-142426608 CCCTTCCCCCTCTGCAGGATGGG + Intergenic
1049966784 9:787197-787219 GCCTCACAGTTCTGCAGGATGGG + Intergenic
1056371341 9:85957557-85957579 ACCTCCCAACACTGCCGCATTGG + Intronic
1056497536 9:87173980-87174002 GCCTCCCAACACTGCCACATGGG + Intergenic
1059255713 9:112929031-112929053 CCCTCCCACCCTTGCCAGATAGG - Intergenic
1060375873 9:123114864-123114886 GCCAGGCTCCTCTGCCGGATTGG - Intronic
1062088853 9:134663448-134663470 GCCTCCCAGCCCTGCCAGGTTGG - Intronic
1062126057 9:134863746-134863768 GCCTGCCACCTCTCCCTAATGGG + Intergenic
1062281427 9:135753651-135753673 ACATCCCACATCTGCGGGATTGG - Intronic
1187774657 X:22742886-22742908 GCAACCCACCTCTTCCGGAATGG - Intergenic
1189232186 X:39461159-39461181 CTCTCCCACCTCTGCAGGATAGG - Intergenic
1194084418 X:89508799-89508821 TCCTCCCACCTCAGCCTAATAGG + Intergenic
1197620681 X:128744001-128744023 GCCTCCCAACACTGCTGCATTGG - Intergenic
1197746390 X:129934294-129934316 GCCTCCCTCTTCTGACAGATCGG - Intergenic
1200116698 X:153772687-153772709 CCCACCCACCCCTGCCGCATGGG - Intronic
1200239727 X:154487136-154487158 TCCTCCCACCTCTCCCAGAGTGG + Intergenic
1200437060 Y:3164684-3164706 TCCTCCCACCTCAGCCTAATAGG + Intergenic
1201474549 Y:14366373-14366395 CCCTCCCACCTCTGCTTCATGGG - Intergenic