ID: 921148869

View in Genome Browser
Species Human (GRCh38)
Location 1:212384475-212384497
Sequence TGGGCACAATTGCAGTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921148869_921148875 14 Left 921148869 1:212384475-212384497 CCCACCAACTGCAATTGTGCCCA 0: 1
1: 0
2: 0
3: 5
4: 93
Right 921148875 1:212384512-212384534 ACATGTCGTCTCTTCCCTTTAGG 0: 1
1: 0
2: 0
3: 12
4: 155
921148869_921148876 20 Left 921148869 1:212384475-212384497 CCCACCAACTGCAATTGTGCCCA 0: 1
1: 0
2: 0
3: 5
4: 93
Right 921148876 1:212384518-212384540 CGTCTCTTCCCTTTAGGTCATGG 0: 1
1: 0
2: 0
3: 7
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921148869 Original CRISPR TGGGCACAATTGCAGTTGGT GGG (reversed) Intronic
900000853 1:14117-14139 TTGGCACAATTGCTGGTGTTGGG - Intergenic
900020567 1:184633-184655 TTGGCACAATTGCTGGTGTTGGG - Intergenic
907360548 1:53910496-53910518 TGGGAAGAATTCCAGTTGTTAGG + Exonic
911894796 1:103418975-103418997 TGTGCAAAATTTCAGTTTGTAGG - Intergenic
912211079 1:107557575-107557597 TGAACACAATTGGAGTTGGGGGG - Intergenic
915068577 1:153246449-153246471 TGGGCACAATTGCCTTGGTTAGG + Intergenic
919150650 1:193693308-193693330 TGGACAGAATAGAAGTTGGTTGG + Intergenic
921148869 1:212384475-212384497 TGGGCACAATTGCAGTTGGTGGG - Intronic
1063301119 10:4849651-4849673 AGGACACAGTTGCAGTTGGGAGG + Intergenic
1068071891 10:52206446-52206468 TGGGAACTAGTGCAGTTGTTTGG + Intronic
1077477755 11:2798337-2798359 TGGGCACAACCCCAGGTGGTTGG - Intronic
1083821730 11:65175415-65175437 TGGGCTCCATTGGAGGTGGTGGG + Intergenic
1084754013 11:71223190-71223212 TGGCCACCATCGCAGTTGGGCGG - Intronic
1085524507 11:77156590-77156612 TGGGCTGAGTTCCAGTTGGTGGG + Intronic
1088815114 11:113415383-113415405 TGGGGACCCTTGGAGTTGGTTGG + Intronic
1089709558 11:120305351-120305373 AGGGCACAGTTGCCATTGGTAGG + Intronic
1090451129 11:126807318-126807340 TGGGCACATTTCCATGTGGTGGG + Intronic
1091373943 12:14244-14266 TTGGCACAATTGCTGGTGTTGGG - Intergenic
1096079792 12:48825780-48825802 TGGGCACAGAAGCAGGTGGTGGG - Intronic
1096394750 12:51257333-51257355 TGGGCACAAATGCAGGTGGCAGG + Intronic
1100661197 12:96700869-96700891 TAGGCACAATACCAGCTGGTTGG + Intronic
1102865587 12:116371465-116371487 TGTGTTCAAGTGCAGTTGGTGGG - Intergenic
1103954626 12:124569134-124569156 TGGGCAGAACTGGAGCTGGTCGG - Intergenic
1104055691 12:125228323-125228345 TGTGAACAATTGCAGATGGTAGG + Intronic
1104177045 12:126342981-126343003 TGGGCACAATATCAGATGCTGGG - Intergenic
1117074695 14:52090319-52090341 TGGGAAAAATTGCATTTGGGAGG - Intergenic
1123425012 15:20163923-20163945 AGGGCACAATGGCAGCTGGGAGG + Intergenic
1123534236 15:21170456-21170478 AGGGCACAATGGCAGCTGGGAGG + Intergenic
1129986307 15:79922891-79922913 TGGGCCCTATTGGGGTTGGTGGG - Intronic
1131443978 15:92480401-92480423 AGGGCTCAGTTGAAGTTGGTGGG - Intronic
1131597672 15:93814257-93814279 TGGGGACTAGTGCAGTTGTTTGG - Intergenic
1132452657 15:101976828-101976850 TTGGCACAATTGCTGGTGTTGGG + Intergenic
1132454242 16:13798-13820 TTGGCACAATTGCTGGTGTTGGG - Intergenic
1136040663 16:27576232-27576254 TGGGCACAATGGGAGTGGCTGGG - Intronic
1136859845 16:33691822-33691844 AGGGCACAATGGCAGCTGGGAGG - Intergenic
1141356691 16:83353409-83353431 TGGGCACCATTGCACATGTTAGG + Intronic
1141890558 16:86924134-86924156 TGGGCGCATTTGCTGCTGGTGGG - Intergenic
1141946222 16:87311543-87311565 AGGGCACAGGTGCAGATGGTGGG - Intronic
1142240906 16:88944585-88944607 TGGCCAGAAGTGCAGTTGGCAGG - Intronic
1203121350 16_KI270728v1_random:1540001-1540023 AGGGCACAATGGCAGCTGGGAGG - Intergenic
1146645357 17:34573637-34573659 TGGGCACGATTTTAATTGGTGGG + Intergenic
1152052221 17:77989202-77989224 TGGGCACAATGGCATTTAGTGGG + Intergenic
1160018229 18:75160146-75160168 TGGACACAAATGCAGACGGTAGG + Intergenic
1161948561 19:7454233-7454255 TGGGCACAATTTGGGTTGGTGGG + Intronic
928744817 2:34399544-34399566 TGGGCAGAATTACAGGGGGTGGG + Intergenic
935650139 2:105374900-105374922 TGGGCAGGCTTCCAGTTGGTAGG + Intronic
936568870 2:113599302-113599324 TTGGCACAATTGCTGGTGTTGGG + Intergenic
937253349 2:120538103-120538125 TGGGCACAGTGGCAGCTGGATGG - Intergenic
1177721598 21:24914489-24914511 AGGGCACACTAGCACTTGGTAGG + Intergenic
1183631420 22:39035269-39035291 TGGGCACAAATTCACTTGGCGGG - Intergenic
1184233127 22:43169092-43169114 TGGGCAGATTTGCAGAAGGTGGG - Intronic
1184670388 22:46009263-46009285 TGGGCACATGTACAGTTGGGTGG - Intergenic
949421677 3:3872660-3872682 TGGACACAAATGCAGGTGGGAGG - Intronic
951348928 3:21581307-21581329 TGGAAACAATTGCATTTGGAGGG - Intronic
953578288 3:44130484-44130506 TGAGCTCAACTGCAGGTGGTGGG + Intergenic
957430842 3:80104331-80104353 TGGGCACTATTTCAGGTGTTGGG - Intergenic
958718793 3:97820911-97820933 TTGGCTCTATTGCAGTTAGTAGG + Intergenic
963326658 3:143870465-143870487 TAGGCACACTTGCAGGAGGTTGG + Intergenic
964974448 3:162602064-162602086 TGGGAACTAGTGCAGTTGTTTGG - Intergenic
968453105 4:684277-684299 TGGGCACAGCTGCAGTGGGGTGG - Intronic
969572936 4:8020635-8020657 TTGGCGAATTTGCAGTTGGTTGG - Intronic
970595900 4:17599914-17599936 TGGGGACAATTCCATTTGCTTGG + Intronic
976576471 4:86677962-86677984 TGGGGCCATTTGCAGTTGGTGGG + Intronic
976910576 4:90300508-90300530 TACGCACACATGCAGTTGGTTGG - Intronic
983542850 4:168931311-168931333 TGGGCACAGTTCCACTGGGTAGG - Intronic
993418808 5:87673856-87673878 TGGGCATATTTGCATTTTGTGGG - Intergenic
997259108 5:132451882-132451904 TGGCCACTAAGGCAGTTGGTGGG - Intronic
999376349 5:151089025-151089047 AGGGCACAGATGCAGTTGGATGG - Intronic
1003051606 6:2785794-2785816 TTGTCACCATTGCATTTGGTGGG + Intronic
1003898046 6:10626310-10626332 TTGGCACAGTTGTAGTTAGTCGG + Intronic
1006436901 6:34030402-34030424 TGGGCCCACATGGAGTTGGTGGG + Intronic
1008418033 6:51266051-51266073 TGGGCATAATTACATTTTGTAGG + Intergenic
1008463118 6:51799004-51799026 TTGGTACATTTGGAGTTGGTAGG - Intronic
1015892160 6:137979908-137979930 TGGGCACAGATGCAGGTGGAGGG - Intergenic
1023710931 7:42992057-42992079 GGGGCACAGTAGCAGGTGGTAGG - Intergenic
1023937963 7:44752867-44752889 TGCGTACAAGTGCAGTTGCTGGG + Intronic
1026594517 7:71723300-71723322 TGGGCACATTTATAGTAGGTTGG - Intergenic
1029562069 7:101309142-101309164 TGAGGACAGTTGCAGTTGGGTGG - Intergenic
1031660627 7:124419806-124419828 TGAGGACACTTTCAGTTGGTTGG + Intergenic
1037682981 8:21113575-21113597 TGGGCTCAATGGGAGTTGTTGGG - Intergenic
1038055972 8:23858050-23858072 TGCGCCCAAGTGCAGTGGGTGGG + Intergenic
1042330235 8:67572279-67572301 TGGGCTCAATGGCAGGTGCTGGG + Intronic
1043942922 8:86216068-86216090 TGGGCTCAAGTCCAGTTGCTTGG - Intronic
1044870808 8:96618028-96618050 TGGGCACAATTTCAGTCCCTGGG + Intergenic
1047524258 8:125618998-125619020 TGGGGACTATTGCAGGGGGTGGG + Intergenic
1048099234 8:131330476-131330498 TGCTCACAAATGCAGTTGTTGGG - Intergenic
1049287059 8:141781592-141781614 TGGGCACATTTTCAGCTGGGTGG - Intergenic
1049623240 8:143608480-143608502 TGGGTACAAAGGCAGTTGATTGG + Intronic
1049883662 9:14230-14252 TTGGCACAATTGCTGGTGTTGGG - Intergenic
1053688713 9:40568735-40568757 AGGGCACAATGGCAGCTGGGAGG - Intergenic
1054299953 9:63369646-63369668 AGGGCACAATGGCAGCTGGGAGG - Intergenic
1054785685 9:69207947-69207969 TGGGTACACTTGTAGTTAGTTGG + Intronic
1055767651 9:79682054-79682076 TCAGCACATTGGCAGTTGGTTGG + Intronic
1059417043 9:114168677-114168699 TGGGCACAATTGAAGTAGAAGGG - Exonic
1062413739 9:136437751-136437773 TGGGCACCATGGCAGTGGGGTGG + Intronic
1187054078 X:15725069-15725091 TTGTCACAATTGCAGTGGGCAGG + Intronic
1188725442 X:33577337-33577359 TGGGAACTAGTGCAGTTGTTTGG + Intergenic
1195769662 X:108336952-108336974 TGGGCAAAATTTGAATTGGTGGG - Intronic
1200402154 X:156025919-156025941 TTGGCACAATTGCTGGTGTTGGG + Intergenic