ID: 921151863

View in Genome Browser
Species Human (GRCh38)
Location 1:212409139-212409161
Sequence ATTTTTCCACAGATGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 974
Summary {0: 3, 1: 17, 2: 68, 3: 210, 4: 676}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921151863_921151870 15 Left 921151863 1:212409139-212409161 CCAACCTCCATCTGTGGAAAAAT 0: 3
1: 17
2: 68
3: 210
4: 676
Right 921151870 1:212409177-212409199 GGTCCCTGGTGCCAAAAAGTTGG 0: 21
1: 53
2: 86
3: 117
4: 159
921151863_921151872 17 Left 921151863 1:212409139-212409161 CCAACCTCCATCTGTGGAAAAAT 0: 3
1: 17
2: 68
3: 210
4: 676
Right 921151872 1:212409179-212409201 TCCCTGGTGCCAAAAAGTTGGGG 0: 26
1: 170
2: 1280
3: 1796
4: 1403
921151863_921151871 16 Left 921151863 1:212409139-212409161 CCAACCTCCATCTGTGGAAAAAT 0: 3
1: 17
2: 68
3: 210
4: 676
Right 921151871 1:212409178-212409200 GTCCCTGGTGCCAAAAAGTTGGG 0: 113
1: 1184
2: 1829
3: 1368
4: 871
921151863_921151866 -6 Left 921151863 1:212409139-212409161 CCAACCTCCATCTGTGGAAAAAT 0: 3
1: 17
2: 68
3: 210
4: 676
Right 921151866 1:212409156-212409178 AAAAATTGTCTTCCACAAACCGG 0: 5
1: 19
2: 28
3: 64
4: 354
921151863_921151867 1 Left 921151863 1:212409139-212409161 CCAACCTCCATCTGTGGAAAAAT 0: 3
1: 17
2: 68
3: 210
4: 676
Right 921151867 1:212409163-212409185 GTCTTCCACAAACCGGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921151863 Original CRISPR ATTTTTCCACAGATGGAGGT TGG (reversed) Intronic
900601326 1:3504028-3504050 CTCATTCCCCAGATGGAGGTGGG + Intronic
901080503 1:6581165-6581187 AGTTTCCCACAGAGGGAGGAGGG - Exonic
901304535 1:8223161-8223183 ATTTTTCCACAGCCGGGGGCTGG - Intergenic
901516792 1:9753081-9753103 ATTTCTCCACAGATGGGGGTGGG + Intronic
901895285 1:12306748-12306770 ATTTTTCCACAGACAGGGTTGGG + Intronic
902065991 1:13688086-13688108 TTTTTTCAACGGATGGAGTTGGG + Intergenic
902104191 1:14019852-14019874 ATTTTTCCATGGATGGCTGTCGG + Intergenic
902592736 1:17486637-17486659 ATTTTTCCACAGACTGAGTCGGG - Intergenic
903088359 1:20884897-20884919 ATTTTTCCACAGACCAGGGTTGG + Intronic
903223806 1:21883892-21883914 ATTTTCCCAAAGATAGAGGCAGG - Intronic
903701935 1:25255558-25255580 ATTTTTCCACAGCTGGGGGTGGG + Intronic
903842083 1:26250432-26250454 ATTTTTCCACAGACGATGGTTGG - Intronic
904353053 1:29921373-29921395 ATTTTTCCACAGACGGGGGTGGG + Intergenic
904564632 1:31421273-31421295 CTTTTTCCACAGATGGCAGCAGG - Intronic
904766462 1:32852508-32852530 AGTTTAGAACAGATGGAGGTGGG - Intronic
905027045 1:34857793-34857815 ATTTTTCCACAGATGGGGGTTGG + Intronic
905765427 1:40596234-40596256 ATTTTTCCACGGATGGCAGGAGG - Intergenic
905998259 1:42401034-42401056 ATTTTTCCACAGATGGGGGTGGG + Intronic
906440242 1:45836877-45836899 GTTTTTCCACAGATGGGTGGAGG + Intronic
907257403 1:53190419-53190441 ATTTTTCCATGGACGGGGGTTGG - Intergenic
907597708 1:55734954-55734976 ATTTTTACAAAGATGGAGAGAGG - Intergenic
907911215 1:58828328-58828350 ATTTTTCCATAGATGGGGCAGGG - Intergenic
907926099 1:58956542-58956564 ATTTTTCCATGGATTGGGGTAGG - Intergenic
908068375 1:60432593-60432615 ATTTTTCTTCAGAGGGAGTTGGG - Intergenic
908588718 1:65604880-65604902 ATTTTTCCACTAATGGGGGATGG - Intronic
908610551 1:65855343-65855365 ATTTTTCCCCAGCTGTTGGTTGG + Intronic
909423901 1:75499219-75499241 ATTTTTCCATGGATGGGGGCCGG + Intronic
909533000 1:76701765-76701787 ATTTTTCCATGGATGGGGGCAGG + Intergenic
910411934 1:86955456-86955478 ATTTTTCCACAGGGGGTGGGCGG - Intronic
910545206 1:88408106-88408128 ATTTTTACACAGATGAAGGAGGG + Intergenic
910621481 1:89260073-89260095 ATTTTTCCACAGAGGGTTGGCGG + Intronic
910687269 1:89930078-89930100 ATTTTTCCAGAAATGGGGGTTGG - Intronic
910754929 1:90678922-90678944 ATTTTTTCATGGATGGGGGTCGG - Intergenic
911147032 1:94562361-94562383 ACTTTTCCACAGACTGGGGTTGG + Intergenic
911363049 1:96903096-96903118 AGTTTTCCACAGATGGACAGTGG + Intergenic
911719730 1:101177819-101177841 ATTTTTCCACAGAGTGGGTTGGG - Intergenic
911903126 1:103530063-103530085 ATTTTTCCACAGGCTGGGGTGGG - Intronic
912120982 1:106472317-106472339 TTTTTTCCCAAGATGGTGGTTGG + Intergenic
913321771 1:117593715-117593737 ATTTCTCCAATGATGGACGTGGG + Intergenic
913610641 1:120506615-120506637 ACTATTCCACAGAGGCAGGTAGG + Intergenic
913984157 1:143550198-143550220 ACTATTCCACAGAGGCAGGTAGG - Intergenic
914319902 1:146549113-146549135 ATTTTTCCACAGATTGGGGGTGG - Intergenic
914381080 1:147117055-147117077 ATGTTTCCACAGAGCAAGGTTGG - Intergenic
914506672 1:148295690-148295712 ATTTTTCCAAATATGCAGGGGGG - Intergenic
914580549 1:149015624-149015646 ACTATTCCACAGAGGCAGGTAGG - Intronic
915100095 1:153492990-153493012 CTTTTTCCACTGATGCAGCTTGG + Intergenic
915254751 1:154618679-154618701 GTTATTCAACAGATGGAGCTGGG + Intronic
915962077 1:160275283-160275305 AGTTTTCCACAGAGGGGGGTGGG - Intergenic
916619211 1:166477563-166477585 ATTTTTCCACAGAGTGGGGTGGG + Intergenic
916908790 1:169321179-169321201 ATTTTGCTAGAGATGGAGTTTGG - Intronic
917031871 1:170701987-170702009 ATTTTTCCATGGATGGGGGAAGG + Intronic
917134319 1:171774489-171774511 ATTTATCCATAGAGGGAGTTTGG - Intergenic
917850622 1:179060633-179060655 AATTTTCCACAGACAGGGGTTGG - Intronic
918234487 1:182566340-182566362 TCTTTTCCACAAATGGAGGTGGG - Intergenic
919527065 1:198666348-198666370 TTTTTTCCACACATGTAGGAAGG + Intronic
919528973 1:198691782-198691804 ATATTTCCAGAGTTGGTGGTTGG - Intronic
919615278 1:199799501-199799523 ATTTTTCTACAGATAGGGGTTGG - Intergenic
919852610 1:201683369-201683391 ATTTTTCCACGGACAGGGGTTGG + Intronic
920580127 1:207098580-207098602 ACTTTTCCACGGATGGGGGTGGG + Intronic
921005751 1:211091726-211091748 CTTCATCCACAGAAGGAGGTAGG + Intronic
921038927 1:211410623-211410645 TTTTTTCAACAGATGGTGCTGGG + Intergenic
921151863 1:212409139-212409161 ATTTTTCCACAGATGGAGGTTGG - Intronic
921322422 1:213954906-213954928 GTTTTTCCACAGACCGGGGTGGG + Intergenic
921589730 1:216989273-216989295 ATTTTTTTAGAGATGGAGATGGG - Intronic
922010214 1:221575749-221575771 ATTTTTCCATGGATGGAGGAGGG - Intergenic
922242567 1:223765498-223765520 GTTTCTGCACAGATGGAGGGTGG + Intronic
922254422 1:223880588-223880610 ATTTTTCCACAGATGCAGGCGGG + Intergenic
922275313 1:224072178-224072200 ATTTTTCCATGGATAGGGGTTGG + Intergenic
922607852 1:226902095-226902117 GTTTTTCCACAGATAGGGGTTGG + Intronic
922781417 1:228256049-228256071 ATTTTTCCACAGATGGGGGTTGG - Intronic
922950381 1:229554130-229554152 ACATTTCCACGGATGCAGGTGGG + Intronic
923512556 1:234665002-234665024 ATTTTTCCACGGTTGGGGGGTGG - Intergenic
923616745 1:235544655-235544677 TTTTTTCCACAGATGTGGGGTGG - Intergenic
924400956 1:243681098-243681120 ATTCTTTCAGAGATGGAGCTGGG - Intronic
1063309836 10:4941705-4941727 GATTTTCCAGAGAAGGAGGTTGG + Intronic
1063317453 10:5020397-5020419 GATTTTCCAGAGAAGGAGGTTGG - Intronic
1063499457 10:6539681-6539703 ATTTTTCCACAGACTGGGGTGGG - Intronic
1063604669 10:7512207-7512229 ATTTTTCCACAGACAGTGGAGGG + Intergenic
1063609484 10:7551219-7551241 ATTTTTCCATCGATGGACTTTGG + Intergenic
1063784274 10:9362873-9362895 ATTTCTCCACGGATGGGGGCGGG - Intergenic
1064020250 10:11803395-11803417 ATTTTTCTACAGAGGAGGGTGGG + Intergenic
1064178411 10:13095413-13095435 ATTTTTCCATGGATGGTGGTGGG + Intronic
1064269492 10:13852111-13852133 ATTTTTCCACAGATGGGGTGTGG - Intronic
1064280200 10:13944535-13944557 ATTTTTCCAAGGACTGAGGTTGG - Intronic
1064296695 10:14085104-14085126 ATTTATAAACAGATGGAGGTGGG - Intronic
1064310394 10:14207288-14207310 ATTTTTCCACGGATGGGGGTGGG + Intronic
1064646382 10:17464350-17464372 TTTTTTCCACAGATGGAGTGGGG - Intergenic
1064744021 10:18461547-18461569 ATTTTTCCACAGGTGGGGAGGGG + Intronic
1065009923 10:21411704-21411726 ATTTTTCCACAGATGCGGGGTGG + Intergenic
1065054169 10:21826734-21826756 TCTTTTCCACAAATGGTGGTGGG - Intronic
1065094208 10:22264551-22264573 ATTTTTGTAGAGATGGTGGTCGG - Intergenic
1065505847 10:26429472-26429494 ATTTTTCCACAGATTGGTGGGGG - Intergenic
1065931582 10:30483989-30484011 ATTTTTCCATGAATGGGGGTAGG - Intergenic
1065939562 10:30551758-30551780 ATTTTTCCACAGACTGGGGTGGG + Intergenic
1066397515 10:35040712-35040734 ATTTTTCCACAGACGGAGTGCGG + Intronic
1066625795 10:37404227-37404249 ATTTTACCTCAGGTAGAGGTTGG - Intergenic
1067269362 10:44775868-44775890 ATTCTTCCAAAGCTGGAGGTTGG - Intergenic
1067314327 10:45147570-45147592 TTTTTTTCACAGATGGATCTAGG + Intergenic
1067415761 10:46101070-46101092 AATTTTCCACAAATGAAGCTGGG - Intergenic
1067435806 10:46276178-46276200 AATTTTCCACAAATGGAGCTGGG - Intergenic
1068017881 10:51541105-51541127 ATTTTTCCACAGAGCAGGGTTGG + Intronic
1068194129 10:53694379-53694401 TTTTTTCCACAGACGGGGGTAGG + Intergenic
1068401303 10:56531174-56531196 AATTTTCCACAGATGTACGGTGG - Intergenic
1068505150 10:57891082-57891104 TTTTTTCCACAGATGGTGGTGGG - Intergenic
1068765543 10:60759225-60759247 ATTTTTCCATGGATGGAGGTGGG + Intergenic
1068861791 10:61855169-61855191 ATTTTTCCACAGACGTAGGTGGG - Intergenic
1068959220 10:62849879-62849901 ATTTTTCCACAGATGGGGGCTGG - Intronic
1069136510 10:64773161-64773183 ATTTTTCCTCAGACAGGGGTGGG - Intergenic
1069357268 10:67601263-67601285 ATTTTTCCACAGATGGTGGATGG + Intronic
1069575249 10:69522759-69522781 ATTTTTCCATGAATGGGGGTTGG - Intergenic
1070056634 10:72941324-72941346 ACTTTTCCCCAGATGGACTTGGG - Exonic
1070795242 10:79212478-79212500 TTTTTTGCACAGATGGGGCTGGG + Intronic
1071323992 10:84493718-84493740 ACTTTTCCACAGATGGGGAGAGG + Intronic
1071357881 10:84816739-84816761 ATTTTTCCATAGATGGGGGTTGG + Intergenic
1071981913 10:91011930-91011952 ATTTTTTCACAGATGTTGGAAGG - Intergenic
1072056050 10:91756957-91756979 ATTTTTCCACAGATGGGGATGGG + Intergenic
1072256883 10:93629610-93629632 ATTTTTCCACAGAATGAGGGTGG + Intronic
1072332696 10:94369233-94369255 ATTTTTCCACAGATCAGGGTGGG + Intergenic
1072424536 10:95318799-95318821 ATTTTTCCACAGATGGGGTGGGG + Intronic
1073498501 10:103915797-103915819 ATTTTTCCGGGGATGGGGGTTGG + Intronic
1073682498 10:105719421-105719443 ATTTTTCCACAGATGGAGGTGGG + Intergenic
1074124556 10:110517684-110517706 ATTTTCCCACAGACGGGGTTCGG - Intergenic
1074314841 10:112351740-112351762 ATTTTGCAGCAGTTGGAGGTGGG - Intergenic
1074663435 10:115690266-115690288 ATTTTTCTACAGATGGGGGTGGG + Intronic
1074851194 10:117440859-117440881 TGTTTTCTAGAGATGGAGGTGGG + Intergenic
1076201312 10:128560848-128560870 ATTTTTCCCCAGATGGCGGAGGG + Intergenic
1076314218 10:129529316-129529338 ACTTTTCCACAGATGGGAGTGGG + Intronic
1076415072 10:130280223-130280245 ATTTTTCCACAGACCCAGGGTGG - Intergenic
1077505141 11:2926587-2926609 ATTTTTCCACGGATGTGGGTGGG + Intergenic
1077860846 11:6178480-6178502 ATTTTTCCACAGACAGGGGAAGG - Intergenic
1078229790 11:9429972-9429994 ATTTTTCCACAGATGGTCCGGGG + Intronic
1078342776 11:10511417-10511439 ATTTTTCCACAGACCAGGGTTGG - Intergenic
1078396625 11:10987399-10987421 ATTTTTCCACAGATGGGAGGGGG - Intergenic
1078405078 11:11063464-11063486 TGTTTCCCAGAGATGGAGGTAGG - Intergenic
1078592277 11:12653550-12653572 TTTTTTCCACAGACCAAGGTAGG + Intergenic
1078681368 11:13479824-13479846 ATTGTTTCACAGATGGTGTTTGG + Intergenic
1079785949 11:24673102-24673124 ATTTTTCCATGGATGGAGGAAGG - Intronic
1080046015 11:27809147-27809169 ATTATTCCACAGACTGGGGTTGG + Intergenic
1080242876 11:30147241-30147263 ATTTTTCCACAGATGGGGGTGGG + Intergenic
1080423637 11:32136402-32136424 AATATTCCACAGATGGATGGTGG + Intergenic
1080470231 11:32538353-32538375 ATTTTTCCATGGATGGGGGTCGG + Intergenic
1080492596 11:32782303-32782325 ATTTTTCCACAGACTGGGGCTGG - Intronic
1080621134 11:33988070-33988092 AGTTTTGCAGAGAAGGAGGTAGG - Intergenic
1080722785 11:34866261-34866283 ATTTTCCCACAGATGGGGTGAGG - Intronic
1080723651 11:34873285-34873307 ATTTTTCCACAGATGGGGGCAGG - Intronic
1080813318 11:35727817-35727839 ATTTTCCCACAGATACAGATGGG - Intronic
1081281182 11:41210840-41210862 ATTCTTCCACTGATGGGGGTTGG + Intronic
1081552564 11:44127554-44127576 ATTTTTCCACAGACTGGGTTTGG - Intronic
1082168221 11:48970645-48970667 ATTTTTCCTAATATGCAGGTTGG - Intergenic
1082235226 11:49815304-49815326 ATTTTTCCTAATATGCAGGTTGG + Intergenic
1082608914 11:55276275-55276297 ATTTTTCCTAATATGCAGGTTGG + Intergenic
1082708842 11:56527915-56527937 ATTTTTCCATGGATGGGGGTTGG + Intergenic
1082841384 11:57692950-57692972 CTTTTTCCACAGATGGGGGCTGG + Intronic
1082900536 11:58245528-58245550 ACTTTTCCACGGACTGAGGTTGG - Intergenic
1083512213 11:63220446-63220468 ATTTTTCCAAAGACAGAGTTTGG - Intronic
1083576675 11:63796899-63796921 ATTTTTCCACAGACAGGGTTGGG + Intergenic
1086009722 11:82085895-82085917 ATGTTTCCATAGACGGAAGTGGG - Intergenic
1086462469 11:87019339-87019361 ATTTTTCCATGAATGGTGGTGGG + Intergenic
1086532904 11:87807171-87807193 ATTTTTCCACAGATTTTTGTGGG - Intergenic
1087160395 11:94942887-94942909 ATTTTTCCACAGATGGTGGGTGG + Intergenic
1087428392 11:98019181-98019203 ATTTTTCCACAGACTGGTGTTGG + Intergenic
1087454849 11:98372112-98372134 ATTTTTCCACAGACCAGGGTTGG + Intergenic
1088346533 11:108833335-108833357 CTTTTTCCATAGATAGAGTTGGG + Intronic
1089249175 11:117144956-117144978 ATTTTTCAACAAAAGGAGGAGGG - Intronic
1089330304 11:117684867-117684889 ATTGCTCCACAGAGGGAGGAAGG + Intronic
1089512760 11:119010891-119010913 GTTTTTCCACAGATGGACCCAGG + Intronic
1090591133 11:128270211-128270233 ATTTTTCCACAGATTGGGGGTGG - Intergenic
1091007953 11:131970719-131970741 TTTTTACCACAGATGCAGGGTGG + Intronic
1091307314 11:134544593-134544615 CTTTTTCCATGGATGGTGGTGGG + Intergenic
1091755327 12:3047612-3047634 ATTTTTCCACGGATGGAGCGGGG - Intergenic
1091792106 12:3277852-3277874 AATTTCCCACAGATGGAGAAAGG - Intronic
1091942280 12:4498714-4498736 ATTTTTCCACAGACTGGAGTTGG + Intronic
1091956178 12:4645420-4645442 ATTTTTCCACGGATGGGAGTGGG + Intronic
1092554554 12:9543196-9543218 ATTTTTCCACAGATGGGGTGGGG + Intergenic
1092734293 12:11565526-11565548 ATTTTCCCACGGATGGGGGTTGG - Intergenic
1093168766 12:15835732-15835754 GTTTTTCCATGGATGGAGTTGGG - Intronic
1093176364 12:15917733-15917755 GTTTTTCCACAGACTGGGGTAGG + Intronic
1093220968 12:16420239-16420261 ATTTTGCTTCAGATGGAAGTGGG - Intronic
1093224538 12:16465778-16465800 ATTTTTCCACAGATTGGGGTGGG - Intronic
1093332970 12:17865843-17865865 ATTTTACCACAGATAAAAGTAGG - Intergenic
1093411897 12:18877602-18877624 ATTTTTCCACAGATGGGGTAAGG + Intergenic
1093651698 12:21653420-21653442 ATTTTTCCACAGATGTGTGAGGG - Intronic
1093661967 12:21767580-21767602 ATTTTTCCACTGATGGGGGTGGG - Intronic
1093766840 12:22973513-22973535 ATTTTTCCACAGATGAGGGTGGG + Intergenic
1094167445 12:27457042-27457064 ATTTTTCCACAGACAGTGGGAGG - Intergenic
1094517545 12:31147439-31147461 ATTTTTCCACAGATGGGGTGGGG - Intergenic
1094645744 12:32322377-32322399 ATTTTTCCACAGATAGGGTGCGG + Intronic
1094719094 12:33044237-33044259 ATTTTTCCACGGATGGGGGATGG + Intergenic
1094747644 12:33364114-33364136 ATTTTTCCACAGACTGGGATGGG - Intergenic
1095145907 12:38725934-38725956 GTTTCCCCACAGATGGGGGTGGG + Intronic
1095184370 12:39184722-39184744 ATTTTTTCACGGATGGGGGGTGG - Intergenic
1095393975 12:41742035-41742057 ATTTTTCCACAGATGGTGGGAGG + Intergenic
1095491051 12:42734219-42734241 ATCTTTCCATAGATGGGGGTGGG + Intergenic
1095980953 12:47974506-47974528 TTTTTTCCCCACGTGGAGGTGGG - Intronic
1096879681 12:54657741-54657763 ATTTTTCCATACACGGAGCTGGG + Intergenic
1097110562 12:56655001-56655023 ATTTTTCCATGGATGGGGGTGGG - Intergenic
1097376248 12:58846441-58846463 ATTTGGGCATAGATGGAGGTAGG + Intergenic
1097394711 12:59059672-59059694 ATTTTTTCACTGATGCAGATGGG + Intergenic
1097580872 12:61454798-61454820 ATTTTGCCACAGACTGATGTGGG + Intergenic
1097824636 12:64162431-64162453 ATTTTTCCACAGATGATAGTGGG - Intergenic
1098606707 12:72399174-72399196 ATTTTTCCACAGACAGAGGTGGG - Intronic
1099222240 12:79929050-79929072 ATTTTTCCACAGATGTGGGTTGG + Intronic
1099747993 12:86732310-86732332 ATTTTTTCACAGACCGGGGTGGG + Intronic
1100053667 12:90482889-90482911 ATTTTCCCAAAGTTGGAGGTGGG + Intergenic
1100324816 12:93530950-93530972 ATTTTTCCACAGACTGGGGTTGG + Intergenic
1100625618 12:96328395-96328417 GTTTTTTCACAGACTGAGGTTGG - Intronic
1100956852 12:99918087-99918109 ATTTTTCCATGGACAGAGGTGGG - Intronic
1100993684 12:100279149-100279171 GTTTTTCCACAGATGGGGGATGG + Intronic
1101375565 12:104168413-104168435 ATTCTTCCACAGATGGGAGCAGG - Intergenic
1101635530 12:106537607-106537629 ATTTTTCCATAGATGGGAGTAGG - Intronic
1101861118 12:108483256-108483278 ATTTTTCCACGGACGGTGGGTGG - Intergenic
1101928632 12:108994036-108994058 ATTAGTCCACAGAAGGAAGTAGG - Intronic
1102747436 12:115261577-115261599 ATTTTTTCATACATGGAAGTGGG + Intergenic
1102919373 12:116780285-116780307 GTTTTTCCACAGATCAGGGTGGG + Intronic
1102925333 12:116821695-116821717 ATTTTTCCACATGTGGAAGGAGG + Intronic
1103226375 12:119291520-119291542 ATTTTTCCACAGACGGGGTCAGG - Intergenic
1103924757 12:124417406-124417428 ACATTTGCACAGAGGGAGGTGGG - Intronic
1104650637 12:130529741-130529763 AGTTTTCCACAGACTGGGGTGGG + Intronic
1104680289 12:130746481-130746503 TTTTTCCCACAGACCGAGGTGGG + Intergenic
1105325489 13:19367129-19367151 ATTTTTCAAAGGATGAAGGTAGG + Intergenic
1105570576 13:21599119-21599141 GTTTCTCCACTGATGGAGGTGGG - Intronic
1105913114 13:24889844-24889866 ATTTGGCCAGAAATGGAGGTGGG - Intronic
1105983978 13:25547669-25547691 ATTTTTCCACAGACTTGGGTGGG - Intronic
1106457187 13:29937670-29937692 ATTTTTCCACAGATGGGGTCCGG - Intergenic
1106474310 13:30084301-30084323 ATTTTTCCACAGATGGGGTGGGG - Intergenic
1107446220 13:40472315-40472337 ATTTTTCCATAGACTGGGGTTGG - Intergenic
1107505977 13:41033739-41033761 ATTTTTCCACAGAAGTTGGTGGG - Intronic
1107721887 13:43258081-43258103 ATGTTTCCACTGCTGGAGGCTGG - Intronic
1107749540 13:43549958-43549980 ATTTTTCCACAGATGGCAGCAGG + Intronic
1107895347 13:44956391-44956413 ATTTTTCCAAAGACAGAGGGTGG + Intronic
1108345866 13:49546434-49546456 ATTTTTCCACGGACCGAGGCGGG + Intronic
1108845179 13:54669603-54669625 ATTTTTCCATGGATGGATGGTGG - Intergenic
1109220488 13:59636448-59636470 CTACTTCAACAGATGGAGGTTGG + Intergenic
1110105461 13:71669570-71669592 TTTTTTCCACTGATGGGGGTGGG - Intronic
1110175404 13:72549871-72549893 ATTTTTCCCCAGAGGGATCTTGG - Intergenic
1110477075 13:75928610-75928632 ATTTTTCCATAGATGGCTGGGGG - Intergenic
1110754239 13:79152749-79152771 ATTTTTCCACAGACTGAGGTGGG - Intergenic
1111046414 13:82819769-82819791 ATTTTTCCTTGGATGGAGGGGGG - Intergenic
1111543598 13:89700749-89700771 AATTCTACACAGATGGATGTGGG + Intergenic
1111668593 13:91300436-91300458 ATTTTTCCACAGACCAGGGTTGG - Intergenic
1112222685 13:97507043-97507065 ATTTTTCCACAGACCATGGTTGG - Intergenic
1112581392 13:100679183-100679205 ATTTTTCCATGGATGGAGTTGGG - Intergenic
1113401466 13:109997924-109997946 GTTTTTCCACAAACTGAGGTGGG - Intergenic
1113626694 13:111853110-111853132 ATTTCTCCACAGATGGGGGGTGG - Intergenic
1114576606 14:23719989-23720011 ATTTTTCCACAGATGGAGCAGGG - Intergenic
1114897138 14:27005020-27005042 ATTTTTCCACGGATGGGGTGAGG - Intergenic
1115327107 14:32152202-32152224 GTTTTTCCACAGATGGGTGGGGG - Intronic
1115788565 14:36854364-36854386 ACTTTTCCCCAGATGGAGCTAGG + Intronic
1116423756 14:44764794-44764816 ATTTTTCCACAGATCAGGGGTGG - Intergenic
1117559130 14:56917930-56917952 ATTTTTCCATATATGGGGGTGGG + Intergenic
1117717248 14:58593965-58593987 ATTTTTCCACAGCTGGGGTTGGG - Intergenic
1117768032 14:59103135-59103157 ATTTTTCCACAGATGACAGTGGG - Intergenic
1118513827 14:66505869-66505891 ATTTTTCCATGGATGGAGATGGG - Intergenic
1118620718 14:67611759-67611781 ATTTTTCCACAGACCAGGGTGGG + Intergenic
1118943046 14:70356188-70356210 ATTTTTCCACAGATGGTGGCGGG + Intronic
1119203754 14:72778603-72778625 ATTTTTCCACCGACTGGGGTCGG - Intronic
1119454434 14:74742514-74742536 GTTTTTCCACAGATGGCAGTGGG + Intergenic
1120428435 14:84381361-84381383 ATTTTTCCACGGATGGGGATGGG + Intergenic
1120806277 14:88754387-88754409 ATTTGTCCAAAGGTGGAGGTGGG - Intronic
1120901615 14:89580581-89580603 AGAATTACACAGATGGAGGTTGG - Intronic
1120988534 14:90354964-90354986 ATTTTTCCACGGATGGGGAGGGG + Intergenic
1121263521 14:92583791-92583813 ATTTTTCCACAGATGGGATGGGG + Intronic
1121292610 14:92789108-92789130 ATGTTTCCACCGCTGGAGGAGGG + Intergenic
1121358124 14:93231897-93231919 ATTTTTCCACGGACAGGGGTCGG - Intergenic
1121497050 14:94399995-94400017 CAATTTCCACGGATGGAGGTTGG + Intergenic
1121644348 14:95507572-95507594 GTTTTTACCCAGATGGAGGTGGG + Intergenic
1122139109 14:99651779-99651801 GTTTTTCAACAGATAGAGGCCGG + Intronic
1122144002 14:99677996-99678018 ATTTTTCCATGGATGGGGGTTGG + Exonic
1122170001 14:99864978-99865000 ATTTTTCCACAGAAGTGGGGCGG + Intronic
1122472767 14:101982674-101982696 ATTTTTCCACAGATGGTTGGGGG - Intronic
1123009398 14:105340440-105340462 GTTTTTCCACAGACGGTGATGGG + Intronic
1123065054 14:105614490-105614512 ATTTTTCCACAGACCAAGATCGG - Intergenic
1123441290 15:20294049-20294071 AGTTTTCAAGAGATGGAGGTGGG + Intergenic
1124574109 15:30892648-30892670 ATTTTTCCACAGATGGGGTAAGG - Intergenic
1124883299 15:33661525-33661547 GTTTTTCCACAGACAGTGGTGGG + Intronic
1124951298 15:34323579-34323601 GTTTTTCCACAGACTAAGGTCGG - Intronic
1125384856 15:39126424-39126446 ATTATTCCAAAAATGGATGTGGG + Intergenic
1125499715 15:40232028-40232050 GTTTTTCCACAGATGGGGGATGG + Intergenic
1126136182 15:45394341-45394363 ATTTTTGCACAGATGGGGTGTGG - Intronic
1126904471 15:53349520-53349542 ATCTTTCAAAAGATGGAGGAAGG + Intergenic
1127441044 15:59008517-59008539 TTTTTTCAACAAATGGTGGTAGG - Intronic
1127441885 15:59017152-59017174 ATTTTTCCACAGACCCAGGGTGG - Intronic
1127550831 15:60036797-60036819 ATTTTTCTACGGATGGGGGTGGG + Intronic
1127618404 15:60709850-60709872 ATTTTTCCACAGAGTGGGGCAGG - Intronic
1128014829 15:64334381-64334403 ATTTTTCCACAGACTGGGGGTGG + Intronic
1128042404 15:64586653-64586675 ATTTTTCCACAGACAGAGGGGGG - Intronic
1128662763 15:69514208-69514230 ATTTTTCCACGGACGGGAGTTGG - Intergenic
1129279199 15:74470517-74470539 ATTTTTCCACAGACCAGGGTAGG + Intergenic
1129406256 15:75320565-75320587 ATTTTTCCACAGACGGGGTTGGG - Intergenic
1129735216 15:77957054-77957076 ATTTTTCCACAGACGGGGTTGGG + Intergenic
1130790851 15:87154521-87154543 CTTTTTCAACAGATGGTGCTGGG + Intergenic
1131360795 15:91788910-91788932 ATTTCTCCAAAGATGGAGTGAGG + Intergenic
1131812926 15:96191347-96191369 CTTTTTCCCCAGCTGCAGGTAGG - Intergenic
1131839420 15:96419778-96419800 ATTTATCCTCAGATGGTGTTCGG + Intergenic
1132076516 15:98825632-98825654 ATTTTTCCACAGATGGGTGGGGG - Intronic
1132620161 16:862097-862119 ATTATTCCAGGGATGAAGGTTGG - Intronic
1133650387 16:7807179-7807201 GTTTTTCCACCCATGGAGGCTGG - Intergenic
1133909339 16:10050728-10050750 GTTTTTCCACAGACCGGGGTTGG - Intronic
1133977311 16:10608492-10608514 ATTTTTCCACAGATGGGGGTTGG - Intergenic
1134459873 16:14421700-14421722 AATTTTCCACGGATGGGGGCGGG - Intergenic
1134472504 16:14539149-14539171 GTTTTTCCACAGAGCTAGGTGGG - Intronic
1135191405 16:20357728-20357750 ATTTTTCCAGGGATGGGGGTGGG + Intergenic
1135868270 16:26125268-26125290 TTTTTTCCACAGATGGGGGTGGG + Intronic
1136362244 16:29788397-29788419 ATTTTTTAAGAGATGGAGGTAGG + Intergenic
1136540473 16:30925302-30925324 AGTTTACCCCAGATTGAGGTTGG + Intronic
1136719920 16:32311480-32311502 AGTTTCCAAGAGATGGAGGTGGG - Intergenic
1136838294 16:33517759-33517781 AGTTTCCAAGAGATGGAGGTGGG - Intergenic
1137689416 16:50411240-50411262 AAGATTCCACAGATGGAGGGTGG - Intergenic
1138731300 16:59198009-59198031 ATTTTTCCACGGATGGGGCGGGG + Intergenic
1139084644 16:63570016-63570038 GTCTTTCAACAGATGGAGGCAGG - Intergenic
1139727876 16:68916471-68916493 ATTTTTCCACACACTGGGGTTGG - Intronic
1140013624 16:71160964-71160986 ATTTTTCCACAGATTGGGGGTGG + Intronic
1140239256 16:73186245-73186267 GTTTTTCCACAGATGGTGAGGGG - Intergenic
1140455027 16:75099995-75100017 ATTCTTCCACAGCAGGAGGCAGG - Intronic
1140522905 16:75597510-75597532 ATTTTTCCACAGATCCGGGGTGG + Intronic
1141216043 16:82024749-82024771 ATTTTTCCACAGATCTTTGTGGG + Intergenic
1141327741 16:83078322-83078344 ATTTTTCCACATATTGGGGACGG + Intronic
1142435079 16:90051506-90051528 ATTTTTCCACAGATGGGCTGAGG - Intergenic
1203006511 16_KI270728v1_random:206289-206311 AGTTTCCAAGAGATGGAGGTGGG + Intergenic
1203148463 16_KI270728v1_random:1818044-1818066 AGTTTCCAAGAGATGGAGGTGGG - Intergenic
1142534829 17:606874-606896 GTTTTTCCAGAGGTGGGGGTGGG - Intronic
1142636278 17:1259763-1259785 ATTTTTGTAGAGATGGGGGTGGG - Intergenic
1143279481 17:5741809-5741831 ATTTTTCCACGGACGGGGGTGGG + Intergenic
1143516008 17:7419545-7419567 AATTTTCCATGGATGGAGGTAGG - Exonic
1143727668 17:8860489-8860511 ATTTTTCCACGGAAGGGGTTTGG - Intronic
1144713616 17:17419550-17419572 ATTTTTCCACAGACTGGGGGTGG - Intergenic
1146738118 17:35257101-35257123 ATTTTTTCACGGATGGGGGTTGG - Intronic
1147412405 17:40263195-40263217 ATTTTTCCATAGATGGTGGGCGG + Intronic
1148251012 17:46080349-46080371 TTTTTTCCCCAAATGGAGGTAGG - Intronic
1148623026 17:49048898-49048920 TTTCTTCCACGGATGGAGGTGGG - Intronic
1149040968 17:52187657-52187679 ATTTTTCCATAGATAGGGGCAGG + Intergenic
1149231865 17:54544379-54544401 ATTTTTCCCCTGCTGGAGCTGGG + Intergenic
1149360436 17:55889412-55889434 AATTTTCCACAGATGTGGGCAGG - Intergenic
1150806743 17:68325491-68325513 GTTTTTCCACAGACAGGGGTTGG - Intronic
1151026760 17:70686018-70686040 ATTTTTCCACAGACCAGGGTAGG - Intergenic
1151331670 17:73413467-73413489 ATTTTTCCATGGATTGGGGTGGG - Intronic
1151573724 17:74940720-74940742 ATTTTTCCATGGATGGAGGGTGG - Intronic
1151836711 17:76586648-76586670 ATTTTTCCACGGAGGGGGGTGGG + Intronic
1153677095 18:7465495-7465517 TTTTCTCCACAGATGGGGGGAGG + Intergenic
1153693321 18:7615685-7615707 ATTTTTCCACAGATGGGGTGGGG + Intronic
1153719496 18:7887453-7887475 GTTGTTCCAGTGATGGAGGTGGG + Intronic
1153845251 18:9043608-9043630 TTTTTTCCATGGATGGGGGTTGG - Intergenic
1153912209 18:9714239-9714261 ATTTTTCCACAGATGGGAGCAGG + Intronic
1154045628 18:10902202-10902224 ATTTTTCCACGGATGGGGGTAGG - Intronic
1154236240 18:12608955-12608977 ATTTTTCCACAAATGGGGGTGGG + Intronic
1155405496 18:25482691-25482713 ATTGTTGCAGTGATGGAGGTGGG - Intergenic
1155459966 18:26067851-26067873 ATTTTTCCACTGATGGTGGCCGG + Intronic
1155908299 18:31478795-31478817 ATTTTTCCACAGACGGCGGCAGG + Intergenic
1156053026 18:32961586-32961608 ATTTTTCCACAGACAGAGCAGGG + Intronic
1156205907 18:34885393-34885415 AATTTTCCACATATTTAGGTAGG - Intronic
1156350097 18:36296330-36296352 ATTTTTCCACGGACAGTGGTGGG - Intergenic
1156530191 18:37807647-37807669 ATTTTTCCACAAGTGGAATTGGG + Intergenic
1156757027 18:40540520-40540542 ATTCTGCCACAAATGAAGGTGGG - Intergenic
1156774664 18:40772372-40772394 ATTTTTCCATGGATGGGGGATGG + Intergenic
1157171409 18:45409818-45409840 ATTTTTCCACAGACCGGGGTTGG + Intronic
1157375624 18:47161688-47161710 ATTTTTCCACAGATGGGTTGGGG + Intronic
1157635438 18:49148870-49148892 ATTTTTCCACGGATGCAGGGTGG + Intronic
1157971507 18:52274901-52274923 ATTTTTCCAATAATGAAGGTAGG + Intergenic
1158289499 18:55923386-55923408 ATTTTTCCACAGACCAGGGTGGG + Intergenic
1158530736 18:58257586-58257608 ATTTCTCCACAGCTGGAGACAGG - Intronic
1158940902 18:62405298-62405320 ATTTTTCCACAGATGGGCTGGGG + Intergenic
1159031132 18:63233461-63233483 GTTTTTCCATAGACGGGGGTGGG + Intronic
1159142585 18:64415448-64415470 ATTTGTCCATAGATGAAAGTTGG + Intergenic
1159324586 18:66897863-66897885 ATTTTTCCACAGATGGTTGGGGG - Intergenic
1159679408 18:71328644-71328666 ATTTTTCTAAAGATCAAGGTTGG + Intergenic
1159937271 18:74379241-74379263 ATTTTTCCACAGACCAAGGTTGG + Intergenic
1160192521 18:76725809-76725831 GTTTTTCCACAGATGGTGGCAGG + Intergenic
1160223199 18:76992197-76992219 GTTTTTCCATGGATGGGGGTGGG + Intronic
1160281391 18:77494047-77494069 ATTTTTCCACAGATGAGATTGGG - Intergenic
1160398912 18:78594611-78594633 ATTTTTCCACAGACTAGGGTAGG + Intergenic
1161143130 19:2660611-2660633 TTTTTTGTACAGATGGTGGTGGG - Intronic
1161286476 19:3471096-3471118 ACTTTTCCCCTGAAGGAGGTGGG + Intergenic
1161431016 19:4232543-4232565 TTTTTTCTACAGATGGGGGGGGG - Intronic
1161564291 19:4991261-4991283 ATTTCACCACAGATGGGGGTAGG - Intronic
1161976284 19:7609573-7609595 ATTTTTCCACAGATGGAGGCAGG + Intronic
1161997418 19:7721983-7722005 ACTTTTCCACAGACTGGGGTGGG + Intergenic
1163120965 19:15217468-15217490 ATTTTTCCACGGACCGGGGTAGG + Intergenic
1163208261 19:15820405-15820427 ATTTTTCCACGGACTGGGGTTGG + Intergenic
1164252537 19:23493858-23493880 AATTTTCCACAGATGTATTTTGG - Intergenic
1164319261 19:24126063-24126085 AATTTTCCACAGATGTATTTTGG + Intronic
1164794038 19:31012080-31012102 GTTTTTCAACAGATGGGGGAGGG - Intergenic
1165235835 19:34420893-34420915 ATTTTTTCACAGACTGAGGTGGG + Intronic
1165242478 19:34479903-34479925 ATTTTTCCACAGACAGGGATGGG - Intergenic
1165703505 19:37957025-37957047 TTTTTTCAACAAATGGAGCTGGG - Intronic
1165996032 19:39844906-39844928 ATTCTACCACACATGGAGGAAGG + Intronic
1166582622 19:43915784-43915806 GTTTTTCCACAGACTGGGGTCGG - Intronic
1166607965 19:44162256-44162278 ATTTTTCCACAAGGTGAGGTGGG - Intergenic
1166612886 19:44215068-44215090 ATTTTTCCACGGATGGGGGCGGG - Intronic
1166910448 19:46151330-46151352 ATTTTTCAACAAATGGTGCTGGG - Intronic
1167170949 19:47831558-47831580 ATTTTTCCATGGATGGGAGTGGG - Intronic
1167925900 19:52820985-52821007 ATTTTCCCAGAGCTGGAGCTGGG + Intronic
1168260304 19:55189814-55189836 TTTTTTGTAGAGATGGAGGTCGG - Intronic
925530519 2:4855756-4855778 ATTTTTCTATAGATTGGGGTAGG - Intergenic
926176422 2:10596237-10596259 AGTTTTCCACAGATGGTGGTGGG + Intronic
926177122 2:10603984-10604006 ATTTTTCCACGGATGCAGGGAGG + Intronic
926514544 2:13825423-13825445 ATTTTTGTACAGATGGATTTGGG - Intergenic
927132220 2:20070360-20070382 ATTTTTCCACGGACAGGGGTGGG + Intergenic
927228063 2:20789876-20789898 ATTTTTCCACAGACTGGGGAGGG - Intronic
927259452 2:21072449-21072471 GTTTTTCCACGGATGGGGATCGG + Intergenic
927505112 2:23607823-23607845 ATTTTTCCATGGATGGGGCTGGG - Intronic
927507822 2:23626072-23626094 ATTTTTCCATGCATGGGGGTAGG + Intronic
927629903 2:24763959-24763981 ATTATGCCACAGATGGCAGTAGG + Intronic
928093092 2:28388246-28388268 ATTTGGCCAGAGAAGGAGGTAGG + Intergenic
928252343 2:29692434-29692456 ATTTTTCCACGGATGGTTTTGGG + Intronic
929008302 2:37416526-37416548 ATTTTTCCACAAAGGGAGGGTGG - Intergenic
929174636 2:38963884-38963906 ATTTTTCCACAGACTGCGGAGGG + Intronic
929484876 2:42344253-42344275 ATTTTTAACCAGATGAAGGTGGG - Intronic
929530156 2:42745553-42745575 ATTTTTACAGAGATGGGGGCAGG + Intronic
930194539 2:48496235-48496257 ATTTGTCCACAGTTGGTGGCTGG + Intronic
931139826 2:59445307-59445329 ATTTTTCCATGAATGGGGGTTGG + Intergenic
932540815 2:72650229-72650251 ATTTTTCCACAAACTGATGTAGG - Intronic
932725367 2:74175384-74175406 ATTTTTCCACAGATCTGGTTGGG - Intronic
932840884 2:75081349-75081371 ATTTTTCACCATATGGTGGTGGG - Intronic
932858121 2:75260254-75260276 ATTATTCCAGAGCTGGGGGTGGG + Intergenic
932959979 2:76402245-76402267 ATTTTTCCACAGGTGGTGGCAGG - Intergenic
933056998 2:77683133-77683155 ATTTTTCCACAGATGGGGCACGG + Intergenic
933361810 2:81296406-81296428 ATATTGCCACATATGGATGTTGG - Intergenic
933450330 2:82441364-82441386 ATTTTTCCATGGATGGGAGTGGG - Intergenic
933845543 2:86323631-86323653 GTTTTTCCATGGATGGGGGTTGG - Intronic
933927130 2:87104276-87104298 ATTTTTCCACAGATGGGGCACGG + Intergenic
935016272 2:99185214-99185236 ATTTTTCCACAGATAGGGAGGGG - Intronic
935327612 2:101951399-101951421 ATTTTTCCACTGATGGACTTTGG - Intergenic
935433121 2:102999385-102999407 ATTTTTCCACAGATGAGGTGTGG - Intergenic
935611190 2:105027381-105027403 ATTTTTCCACCAATGGTGTTTGG + Intergenic
935891314 2:107681805-107681827 ATTTTTCCACAGACCAGGGTGGG + Intergenic
936034540 2:109100437-109100459 ATTTTTCCACGGACTGAGATGGG - Intergenic
936083126 2:109448774-109448796 ATTTTTCCACAGACTGAGGCAGG - Intronic
936958058 2:118043211-118043233 ATTTTTCAACAAATGGTGCTGGG - Intergenic
937167202 2:119831042-119831064 ATTTTTCCATGGATGGGGGGTGG + Intronic
937421526 2:121760311-121760333 ATTTTTCCACAGAAGGGGGGCGG - Intronic
937650637 2:124315319-124315341 AGTTTTCCTCTGATGGAGGAAGG - Intronic
938985373 2:136570414-136570436 GTTTTTCCACAGATGTGGATGGG + Intergenic
939370428 2:141292236-141292258 ATTTTTCCACAGACCGGGATGGG - Intronic
939708718 2:145487975-145487997 ATGTTTCCCCAGTTTGAGGTTGG - Intergenic
939848495 2:147276580-147276602 TTTTTTCCACAGAAGGTAGTTGG + Intergenic
939971246 2:148663732-148663754 ATTTTTCCATGGATGAGGGTGGG + Intronic
940312371 2:152292124-152292146 ATTTTTCCATGGATGGTGGTGGG - Intergenic
940874773 2:158887700-158887722 ATTTTTCCCCATATCCAGGTGGG - Intergenic
940948463 2:159645381-159645403 ATTTTCCCACAGATGGAGCAAGG + Intergenic
941367308 2:164623102-164623124 ATTTTTCCACGGATGGGGTGGGG - Intergenic
941509030 2:166383014-166383036 TTTTTTTCACAGACAGAGGTGGG - Intergenic
942100622 2:172579230-172579252 ATGTTTCCAGGGATGGGGGTGGG + Intronic
942104937 2:172624524-172624546 ATTTTTCCATGGATGGTGTTCGG - Intergenic
942235805 2:173903977-173903999 ATTTTTTCATGGATGGGGGTCGG + Intergenic
942477664 2:176344897-176344919 ATTTTTCCACTGAACAAGGTGGG - Intergenic
942497752 2:176557649-176557671 ATTTTTCCACAGATGTTGGGGGG - Intergenic
942549810 2:177103629-177103651 ATTTTTCCACAGACCGGGCTGGG + Intergenic
942628169 2:177925995-177926017 ATTTTTCTTCAAATGGAGGAAGG - Intronic
942810013 2:179987927-179987949 ATTTTTCCACAGATGTTAGGGGG + Intronic
942993593 2:182233279-182233301 ATTTTTCTACAGACTGAGTTGGG + Intronic
943156609 2:184187508-184187530 ATTTTTCCACATATGGGAGTGGG + Intergenic
943162298 2:184269847-184269869 ATTTTTCCATGGATGGGGGTGGG + Intergenic
943256732 2:185602996-185603018 ATTTTTACACGGATGGGGTTGGG - Intergenic
943278785 2:185902969-185902991 ATTTTTCCATGGATGTGGGTCGG + Intergenic
943648839 2:190435068-190435090 ATTTTTCCTCAGATGGAGAGGGG - Intronic
943745173 2:191454694-191454716 ATTTTTTCACAGTTGGAGGTGGG + Intergenic
944068754 2:195646887-195646909 CTTTTTCCACAGATGGCAGGGGG - Intronic
944069463 2:195653020-195653042 ATTTTTCCACAGATGGGGGTGGG - Intronic
944101814 2:196035888-196035910 ATTGTTCCAGAGATGGAACTTGG + Intronic
944260369 2:197669522-197669544 GTTTTTCTACAGATGTGGGTGGG + Intronic
944683043 2:202094329-202094351 ATTTCCCCAAAGATGGGGGTTGG - Intronic
944777431 2:202981150-202981172 ATTTTTCCACAGACCCAGGGTGG + Intronic
945690793 2:213032770-213032792 ATCTTTCCACTGGTGGAGGAGGG + Intronic
945933450 2:215879804-215879826 ATTTTTCCACAGATGGTGGAGGG + Intergenic
946288874 2:218728136-218728158 ATTTTTCCACTGACTGGGGTGGG + Intronic
946502751 2:220267200-220267222 ATTTTTCCATGGATGGTGGGTGG + Intergenic
946649472 2:221875250-221875272 ATTTTTCCACGGATGGGGGTAGG - Intergenic
946739797 2:222790248-222790270 ATTTTTCCACAGACGGTGGCAGG + Intergenic
946995005 2:225381476-225381498 ATTTTTCAACAGACTGGGGTGGG + Intergenic
947000875 2:225454776-225454798 CTTTTTCCACAGATGGGGAGGGG - Intronic
948535789 2:238645686-238645708 ATTTTTCCACAGACCGGGGAAGG - Intergenic
948539806 2:238682525-238682547 ATTTTTCCACAGATGGGGCTGGG + Intergenic
948615072 2:239193256-239193278 AATTTCTCACAGATGGAGGGAGG + Intronic
1169322050 20:4640987-4641009 ACTTTTCCACAGATGGGTGGGGG - Intergenic
1169640006 20:7741245-7741267 ATTTTTCCACAGATAGTGGTGGG + Intergenic
1170453317 20:16508440-16508462 ATTTTTCCACAGATAGGGGTAGG + Intronic
1171162340 20:22939163-22939185 TTTTTTCCACAGATAGAGGGAGG - Intergenic
1172575508 20:36005221-36005243 ATTTTTTCACAGATGGGGGCAGG + Intronic
1173051958 20:39571866-39571888 GTTTTTCCACAGGTCGGGGTCGG + Intergenic
1173719061 20:45237252-45237274 ATTTTTCCATGGATAGGGGTGGG - Intergenic
1173926016 20:46781818-46781840 GTTTTTCCACAGATGGGGGCAGG + Intergenic
1174064252 20:47853135-47853157 ATTTTTCCATGGACTGAGGTGGG + Intergenic
1174635537 20:51996269-51996291 GTTTTTCCACAGACTGGGGTTGG + Intergenic
1174661122 20:52214114-52214136 ATTTTTCCACGAATGGGTGTGGG + Intergenic
1174906459 20:54557262-54557284 ATTTTTCCACAGACGGGGTTGGG + Intronic
1176153653 20:63607034-63607056 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153660 20:63607067-63607089 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153667 20:63607100-63607122 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153685 20:63607201-63607223 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153692 20:63607234-63607256 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153718 20:63607370-63607392 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153733 20:63607436-63607458 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153753 20:63607539-63607561 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153761 20:63607573-63607595 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153789 20:63607711-63607733 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153818 20:63607848-63607870 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153941 20:63608492-63608514 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153955 20:63608560-63608582 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153975 20:63608662-63608684 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153989 20:63608730-63608752 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154003 20:63608798-63608820 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154031 20:63608935-63608957 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154119 20:63609416-63609438 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154140 20:63609518-63609540 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154153 20:63609585-63609607 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154167 20:63609652-63609674 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154174 20:63609685-63609707 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154188 20:63609754-63609776 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154196 20:63609788-63609810 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154223 20:63609926-63609948 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154231 20:63609960-63609982 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176295533 21:5070139-5070161 ATTTTTCCATGGATGCAGGTAGG + Intergenic
1176308532 21:5137055-5137077 ATTTTTCCACAGACAGGGTTGGG - Intronic
1177051622 21:16241968-16241990 ATCTCACCACAGAGGGAGGTGGG - Intergenic
1177679186 21:24341810-24341832 AATTTTTCACAGATGGGGGAAGG + Intergenic
1177714142 21:24817545-24817567 GTTTTTCCACAGACAGACGTGGG - Intergenic
1178306161 21:31491809-31491831 ATTTTTTCAAGGATGGAGGTTGG + Intronic
1178319776 21:31596583-31596605 ATTTTTCCATACATGGGGGTGGG - Intergenic
1178415932 21:32405116-32405138 ATTTTTCCAAAGATGGGGGTTGG + Intergenic
1178784399 21:35639318-35639340 ATTTTAACACAGCTGTAGGTTGG + Intronic
1179848527 21:44124977-44124999 ATTTTTCCACAGACAGGGTTGGG + Intronic
1179861517 21:44191985-44192007 ATTTTTCCATGGATGCAGGTAGG - Intergenic
1179898073 21:44374380-44374402 GTTTTTCCACAGATGGGGGCGGG + Intronic
1180100742 21:45583764-45583786 ATTTTTCCACAGATGAGGGGTGG + Intergenic
1180579224 22:16813614-16813636 ATGTTTCCAGATGTGGAGGTGGG - Intronic
1180936182 22:19626755-19626777 ATTTTTCCACAGACCGAGGGTGG - Intergenic
1180938513 22:19641716-19641738 ATTTTTCCACCGATGGGGTTGGG - Intergenic
1181020111 22:20095653-20095675 ATTTTTCCACAGACGGTGTTGGG + Intronic
1181846830 22:25717010-25717032 ATTTTTCCACAGACGGGGATGGG - Intronic
1182028123 22:27136300-27136322 ATTTTCCCACAGCAGGGGGTAGG + Intergenic
1182211532 22:28680788-28680810 AGTTTTCAAGAGATGGAGGCGGG - Intergenic
1183503663 22:38196443-38196465 ACTTTTCCACAGATGAGGGTGGG + Intronic
1184623852 22:45706101-45706123 ATTTTTCCATAGACAGGGGTGGG - Intronic
1184706306 22:46215943-46215965 ATTTTTCCACAGATGGGGGTGGG - Intronic
1185022942 22:48390815-48390837 GTATTTCCAGAGAAGGAGGTTGG + Intergenic
1185125465 22:49008313-49008335 ATATTTCCACGGACGGAAGTAGG + Intergenic
1185189455 22:49425206-49425228 ATTTTCCCACGGATGGAAGTGGG + Intronic
949333781 3:2951238-2951260 ATTTTTCCACAGATGGCGGGTGG + Intronic
949434410 3:4013048-4013070 ATTTTTCCCCATATGGAGGTGGG + Intronic
951551427 3:23878909-23878931 ATTTTTCCACAGATGGGGGGTGG - Intronic
951553621 3:23899024-23899046 ATTTTTCCACAGATGGAGATGGG - Intronic
952186164 3:30971394-30971416 ATTTTCTCACAGATTGAGGTAGG + Intergenic
952248705 3:31627382-31627404 ATTTTTCCACGGATGGCGGAGGG - Intronic
952459005 3:33504656-33504678 ATTTTTCCACGGATGGGGAAGGG + Intronic
952786989 3:37165373-37165395 ATTTTTCCATGGACGGGGGTGGG - Intronic
953227422 3:41033443-41033465 ATTTTTCCACGGATGGGGGAAGG + Intergenic
953488727 3:43328570-43328592 ATTCCTCCACAAATGGGGGTGGG - Intronic
953642520 3:44722579-44722601 ATGTTTCCAGAAATGGAGGTGGG + Exonic
953707015 3:45238882-45238904 ATTTTTCCACACATGGGGTAGGG - Intergenic
953872560 3:46639951-46639973 ATTTTTCCACAGACCAGGGTGGG + Intergenic
953967249 3:47318832-47318854 ATTTATCCAAGGATTGAGGTTGG - Intronic
954055243 3:48017893-48017915 ATTTTTCCACAGATAGCAGGAGG + Intronic
954592203 3:51792497-51792519 ATTTTTCCATGGACGGGGGTTGG + Intergenic
954725032 3:52601309-52601331 ATTTTTCCACAGACAGGGATGGG + Intronic
955157504 3:56431240-56431262 GTTTTTCCAAAAATGGAGCTAGG - Intronic
955904162 3:63789286-63789308 ATTTTTCCATGAATGGAGGAAGG - Intergenic
956335819 3:68162270-68162292 ATTTTTCCACAGATGGGGTTGGG + Intronic
956764428 3:72472458-72472480 ATTTTCCCACAGACCGGGGTTGG - Intergenic
957346357 3:78966200-78966222 ATTTTTCCACAGACAGAGAGGGG - Intronic
957537755 3:81528552-81528574 ATTTGTCCAAAGGTGAAGGTGGG + Intronic
957724208 3:84044035-84044057 ATTTATCCATAGATGGAGGTTGG + Intergenic
957801585 3:85090885-85090907 ATTTTTCCACAGATGGAAAGGGG - Intronic
957833519 3:85554094-85554116 ATTTTTCCACAGAAGTAGTCAGG + Intronic
957856172 3:85881795-85881817 ATTTTTCCATGGATGGTGGGCGG + Intronic
958189186 3:90162623-90162645 ATTTTTCCACAGATTGGTGGTGG + Intergenic
958882634 3:99690422-99690444 TATTTTCCTCAGATGAAGGTGGG + Intronic
958946816 3:100371735-100371757 ATTTTTGCATGGATGGGGGTAGG + Intronic
959106531 3:102071160-102071182 ATTTTTCCATGGATGGGGGAGGG + Intergenic
959181648 3:102987679-102987701 ATTTTTCCACGGACAGGGGTGGG + Intergenic
959260579 3:104074610-104074632 AATTTTCCACAGATGTAGAGAGG + Intergenic
960086139 3:113593462-113593484 ATTTTTCCACAGACGGGGGTGGG - Intronic
960326368 3:116300720-116300742 ATTTTTCCACAAACTGGGGTAGG - Intronic
960333317 3:116389259-116389281 ATTCTACCACAGCTGGAGGTAGG - Intronic
960672910 3:120169344-120169366 GTTTTTCCACAGATAGTGGTGGG - Intronic
960796318 3:121492040-121492062 ATTTTTCCACAGACCGGGGGTGG - Intronic
960960199 3:123065356-123065378 AGTTTTCCACAGATGGTGGGGGG + Intergenic
961086048 3:124068242-124068264 TGAGTTCCACAGATGGAGGTGGG - Intergenic
961488775 3:127236253-127236275 AATTTTCCACAGATGAGGGGAGG - Intergenic
961580809 3:127880478-127880500 ATTTTTCCACTGATGAGGGTGGG + Intergenic
961727263 3:128939718-128939740 ATTTTTCCACGGACGGGGTTGGG + Intronic
961842044 3:129722408-129722430 ATTTTTCCACAGATGGGGTCGGG - Intronic
962518292 3:136174041-136174063 CTTTTTCAACAGATTGAGGGAGG - Intronic
962574628 3:136745439-136745461 ATTTTTCCACGGATGGGGTGGGG + Intronic
962775447 3:138654990-138655012 ACTTTTCCACACCTGGGGGTTGG - Exonic
962856352 3:139349264-139349286 ATTTTTCCTCAGAAGGATTTTGG - Intronic
962857655 3:139363465-139363487 ATTTTTCCACAGATGGGAAGGGG - Intronic
962950735 3:140216215-140216237 ATTTTTCCATGGATGGGGGTGGG - Intronic
963166375 3:142208523-142208545 TTTTTTCAACAGATGGTGCTGGG - Intronic
963305515 3:143648301-143648323 ATTTTTCCACGGATTGGGGGAGG + Intronic
963704512 3:148669368-148669390 ATTTGAACACAGATGTAGGTAGG - Intergenic
964209624 3:154212579-154212601 ATTTTTCCACAGACGGGTGGGGG + Intronic
964264034 3:154873925-154873947 ATTTTTCCACAGATGGGGTCAGG - Intergenic
964583115 3:158261995-158262017 ATTTTTCCATGGATGGGGCTGGG - Intronic
964792016 3:160461174-160461196 ATTTGTCCACAGATCAGGGTTGG - Intronic
965147936 3:164930004-164930026 ATTTTTCTACAGATAGAACTTGG + Intergenic
965675412 3:171190172-171190194 ATTCTCCCACTGATGGAAGTGGG + Intronic
965761248 3:172079342-172079364 CTTTCTCCAAAGATGGAGTTTGG + Intronic
965846304 3:172966303-172966325 ATTCTTCATCAGGTGGAGGTTGG - Intronic
965946069 3:174242802-174242824 ATTTTTCCATGGATGGGGGCGGG - Intronic
966271623 3:178114598-178114620 ATCTTTCAACAAATGGTGGTGGG + Intergenic
966358439 3:179107447-179107469 ATTTTTCCACAGACTGGGGTAGG + Intergenic
966563713 3:181352226-181352248 GTTTTTCCACAGATGGGAGTAGG + Intergenic
967455160 3:189676862-189676884 ATTTTTCCACTGATGTTGGGGGG - Intronic
967597801 3:191348252-191348274 ATTATTACACAGATGATGGTGGG - Intronic
968806368 4:2775605-2775627 GTTTTTCTTCAGATGCAGGTGGG + Intergenic
969925938 4:10585925-10585947 GTATTTCCACAGATGGGGGTGGG + Intronic
970008853 4:11436669-11436691 ATTTTTCCACAGACCCGGGTGGG + Intergenic
970038807 4:11772501-11772523 ATTTTTCCACAGACTGGGATGGG + Intergenic
970328846 4:14957769-14957791 CTTTCTCCACAGAAGGAGGAAGG + Intergenic
970690395 4:18612965-18612987 ATTTTTCCACAGATGAGGGTTGG + Intergenic
970900485 4:21152902-21152924 ATTTTTCCACAGACAGGGTTGGG - Intronic
972670444 4:41209937-41209959 ATTTTTCCACGGATGGGGTTGGG + Intronic
972744837 4:41922761-41922783 ATTTTTCCACAGACGGGAGTAGG - Intergenic
973095968 4:46200177-46200199 GTTTTTCCACAGATGTTGGGTGG - Intergenic
973117467 4:46478878-46478900 ATTTTTCCACGGACGGGGATGGG - Intergenic
973212458 4:47631672-47631694 ATTTTTCCACAGACTGGGATGGG - Intronic
973654233 4:53029212-53029234 ATTTTTCCAAAGATGAAGATTGG - Intronic
974076365 4:57172018-57172040 ATATTTCCAAGGATGGTGGTCGG + Intergenic
975070688 4:70133850-70133872 ATTTTTCCACGGATGAGGGCGGG - Intronic
975133518 4:70851379-70851401 ATTTTTCCACAGACCAGGGTAGG - Intergenic
975540484 4:75505055-75505077 ATTTTTCCATGGACCGAGGTTGG + Intronic
975646952 4:76555176-76555198 ATTTTTCCACGGATGGGGTGTGG - Intronic
975725328 4:77285957-77285979 ATTTTTCCACAGAAGGGTCTGGG + Intronic
975798754 4:78036440-78036462 ATTTTTCCATGGATGGAGGTGGG + Intergenic
975905726 4:79209797-79209819 ATACTTTCAGAGATGGAGGTGGG + Intergenic
976084018 4:81388812-81388834 AGTATTCTAGAGATGGAGGTGGG + Intergenic
976097353 4:81523351-81523373 TTTTTTTAACAGATGGAGATAGG + Intronic
976417901 4:84800683-84800705 ATTTTTTCACAGATGGATTGTGG + Intronic
976456748 4:85256699-85256721 TTTTTTCCACAGATTGAAGAGGG + Intergenic
976687853 4:87835779-87835801 ATTTTTCCACCGTGAGAGGTGGG - Intronic
976822291 4:89220051-89220073 ATTTTTCCATGGATGGGAGTAGG - Intergenic
977092033 4:92689666-92689688 ATGTTTCTAAAGATGGGGGTGGG - Intronic
977265595 4:94849727-94849749 ATCTGGCCACAGATGCAGGTTGG + Intronic
977810527 4:101350204-101350226 ATTTTCCCATGGATGGTGGTTGG + Intergenic
977880518 4:102199087-102199109 ATATTTCCACATATGGATTTTGG + Intergenic
977957946 4:103052141-103052163 ATTTTTCCACTGATGGCAGGGGG + Intronic
978479701 4:109175074-109175096 ACTTTTACACAGATGGGAGTGGG - Intronic
978754473 4:112287076-112287098 CTTTTTCCACAGACTGGGGTTGG + Intronic
978901921 4:113961399-113961421 ATGTTACATCAGATGGAGGTTGG + Intronic
979027331 4:115594166-115594188 ATTTTTCAACAACTGGTGGTGGG + Intergenic
979619180 4:122779273-122779295 GTGATTCCTCAGATGGAGGTGGG - Intergenic
979651467 4:123136964-123136986 ATTTTTCCACAGGTGTGGGGCGG + Intronic
979661519 4:123261088-123261110 ATTTTTCCACAAATGGGGTGGGG - Intronic
979729262 4:124003941-124003963 ATTTTTGAACAGAGGGAGGAAGG + Intergenic
979920797 4:126493414-126493436 ATTTTTCCACAGATGAAGTAGGG + Intergenic
980016669 4:127657914-127657936 ATTTTTCCACAGACCAGGGTTGG - Intronic
980193136 4:129551306-129551328 ATTTTTCCGCGGATGGACCTGGG - Intergenic
980656561 4:135794436-135794458 ATTTTTCCACAGACTGGAGTGGG + Intergenic
981268083 4:142811172-142811194 ATATATGCACAGGTGGAGGTAGG - Intronic
981467721 4:145093097-145093119 AGTATTCTACAGCTGGAGGTAGG + Intronic
981671060 4:147287476-147287498 ATTTGTCCAGATATGGAGGAGGG + Intergenic
981734741 4:147937072-147937094 ATTTTTCCACCGATTGGGGTGGG - Intronic
981786308 4:148483110-148483132 ATTTTTCCACAGACTGGGGTGGG - Intergenic
981961946 4:150551933-150551955 ATTTTTCCACAGACCAAAGTGGG + Intronic
982086303 4:151840212-151840234 ATTTTTCCACAGACTGGGGGTGG - Intergenic
982089426 4:151867558-151867580 AATGTTGCACAGATGGAGCTGGG + Intergenic
982473498 4:155822468-155822490 ATTTTACCAGAGTTGGAAGTAGG - Intergenic
982896920 4:160942005-160942027 AGTTTTCCACAGATGGGGGTGGG + Intergenic
983040859 4:162924043-162924065 ATGTTTCCATAGATGGGGGTGGG - Intergenic
983193931 4:164783750-164783772 ATTTTTTCAGAGATGGAGGTGGG - Intergenic
983700095 4:170581397-170581419 ATTTTTCCACAGAAGGGGCCAGG + Intergenic
983923943 4:173376018-173376040 ATTTTTGCACAGATTGAGGGTGG - Intronic
984041308 4:174737658-174737680 ATTTCTCCAGACATGGTGGTGGG - Intronic
984072933 4:175139036-175139058 ATTTTTCCACAGACTGGGGTGGG + Intergenic
984259100 4:177423243-177423265 GTTTTTCCACACAAGGATGTGGG - Intergenic
984364929 4:178786273-178786295 ATTTTTCCATGGATGGGGGGTGG + Intergenic
984376856 4:178942364-178942386 ATTTTTCTATGGATGGAGGAAGG - Intergenic
984385269 4:179047845-179047867 ATTTTTCCAGGGATGGTGGGTGG + Intergenic
984588671 4:181591787-181591809 ATTTTTCCACAGACAGGAGTAGG - Intergenic
984609289 4:181819594-181819616 AATTTTCCACAGATGGAGGGTGG + Intergenic
984736082 4:183109453-183109475 ATTTTTCCACAGAATGGGATTGG + Intronic
985122426 4:186657466-186657488 ATTTGACTAGAGATGGAGGTGGG + Intronic
985143861 4:186872634-186872656 ATTTTTCCACAGACCAGGGTGGG - Intergenic
985363140 4:189197003-189197025 ATTTTTTCATAAATGGATGTTGG + Intergenic
985624028 5:975278-975300 ATTTTTCCACTGATGGAGAAGGG - Intergenic
985624078 5:975686-975708 ATTCTTCCACTGATGGAGAAGGG - Intergenic
985624102 5:975890-975912 ATTCTTCCACTGATGGAGAAGGG - Intergenic
985887315 5:2689634-2689656 ATTTTTCCATAGATGGGGCAAGG - Intergenic
986232319 5:5877643-5877665 ATTTTTCCACAGAAGAACCTGGG + Intergenic
986306872 5:6522736-6522758 ATTTTTCCAGAGATGGAGGCTGG + Intergenic
986404323 5:7410737-7410759 TTTTTTCCACAAAGGGAGGAGGG + Intronic
986778151 5:11038465-11038487 ATTTTTCCATGGACTGAGGTCGG - Intronic
987134977 5:14892002-14892024 ATTTTTCCGCAGATGGAGTAGGG - Intergenic
987230702 5:15890677-15890699 ATTTTTTCACACATGCAGGGAGG - Intronic
988390047 5:30616172-30616194 ATTTTTCCACGGATGGAGGGGGG - Intergenic
988392911 5:30658872-30658894 ATTTTTCCATGGATGGTGGAAGG + Intergenic
988440644 5:31228584-31228606 ATTTTTCCACAGATGTGGTGGGG + Intronic
988626143 5:32876760-32876782 ATTTTTCCGCGGATGGGGATGGG - Intergenic
988813599 5:34808792-34808814 ATTTTTCCATGGATGGGGGTGGG + Intronic
988882396 5:35517352-35517374 ATTTCTCCAGGCATGGAGGTAGG - Intergenic
989472487 5:41836558-41836580 CTTTTTCCACAGATGGGGGTTGG + Intronic
989566752 5:42908894-42908916 ATTTTTCTACGGATGGAGAGGGG + Intergenic
989684322 5:44067054-44067076 ATTTTTCCATAAATAGAGCTAGG - Intergenic
989743442 5:44799059-44799081 GTTTTTCCACGGACTGAGGTGGG - Intergenic
989799096 5:45513742-45513764 ATTTTTCCACAGTCAGGGGTGGG - Intronic
990650836 5:57897867-57897889 ATTTTTCCACGGATGGAGGTTGG + Intergenic
990972147 5:61519804-61519826 GTTTTTCCACGGATGGGGGGTGG + Intronic
991066235 5:62427759-62427781 ATTTTTCCACAGATGGGGCAGGG - Intronic
991172665 5:63646599-63646621 ATTTTTCCACAGATGGGGTGGGG + Intergenic
991625242 5:68594299-68594321 ATTTTTCCACAGATGGGGGTGGG - Intergenic
991985953 5:72287210-72287232 GTTTTTCCACAGCTGGGGGTTGG - Intronic
992285218 5:75227988-75228010 ATTTTTCCCAGGATGGCGGTTGG - Intronic
992299598 5:75364588-75364610 ATTTTTCTACAGATGGGGTGGGG + Intergenic
992485650 5:77191722-77191744 ATATTTCCACAGATCGAAGGTGG + Intergenic
992862818 5:80929365-80929387 AATGTGCCACAGATGGAGCTAGG + Intergenic
993140373 5:84025574-84025596 ATTTTTCCACAGACTGGGTTGGG - Intronic
993164584 5:84335927-84335949 CTGTTTCCTCAGATGGAGGAAGG + Intronic
993574120 5:89580413-89580435 ATTTTTGTAGAGGTGGAGGTGGG + Intergenic
993855261 5:93066379-93066401 ATTTTTCCACAGATGGGGGTTGG - Intergenic
993913115 5:93708444-93708466 ATTTTTCCACACATGGGGAGTGG + Intronic
993954809 5:94219071-94219093 ATTTTTCCACAGATGGGGGCGGG + Intronic
994112342 5:96020839-96020861 ATTTTTCCACAGATGGGTTGGGG - Intergenic
994329462 5:98488612-98488634 ATTTTTATACAGATGGGGGTGGG + Intergenic
994708876 5:103241528-103241550 ATTTTTCCACAGATGAGGTGTGG - Intergenic
994938216 5:106284378-106284400 ATTTTTCCACGGATGGGGTAGGG + Intergenic
995056132 5:107761099-107761121 ATTTTTCCTCACATAAAGGTTGG + Intergenic
995087422 5:108129430-108129452 ACTTTTCAACAGATAGTGGTAGG - Intronic
995225186 5:109692774-109692796 GTTTTTCCACAGACAGGGGTGGG + Intronic
995340942 5:111058481-111058503 ATTTTTCCCCTGCTGGAGCTAGG - Intergenic
995548758 5:113258615-113258637 ATTTTTCCACAGACAGTGGCAGG - Intronic
995952457 5:117732532-117732554 ATTTTTCCATAGACTGGGGTGGG + Intergenic
995962017 5:117853286-117853308 ATTTTTCTACAGATGGGGTCAGG + Intergenic
996228326 5:121029982-121030004 ATTTTTCCACAGACTGTGGTGGG + Intergenic
996331179 5:122330734-122330756 ATTTTTCCATAGTTGGGGGAGGG + Intronic
996444833 5:123535333-123535355 ATTTTTACATAGTTGGGGGTGGG - Intronic
996808695 5:127488865-127488887 ATTTTTCCATGGATGGGGATGGG + Intergenic
997098165 5:130937408-130937430 ATTTTTCCGCAGATGAAGGGGGG - Intergenic
997169457 5:131701226-131701248 ATTTTTTCACGGATGGGGCTGGG - Intronic
997221968 5:132176768-132176790 ATTTTTCCATGGACGGGGGTTGG - Intergenic
997715619 5:136040550-136040572 ATATTTCCCCAGATGGTGGCAGG - Intronic
997898385 5:137740670-137740692 ACTTTTCCAAGGATGGGGGTGGG + Intergenic
997963756 5:138341578-138341600 ATTTTTCCACCGATAGAGAAGGG + Intronic
998008064 5:138670685-138670707 ATTTTTCCACAGACGGAGGGAGG + Intronic
998143702 5:139713594-139713616 ATCTTTCCAAAGAGGGAAGTGGG - Intergenic
998240787 5:140442405-140442427 ATTTTTCCACACGTGGGGGAGGG + Intronic
998915792 5:147010284-147010306 ATTTTTCCACAGACTGGGGCAGG + Intronic
999193734 5:149767811-149767833 GTTTTTCCACAGATGGGGTTGGG + Intronic
999512640 5:152268708-152268730 ATTTTTCCACAGATGGTTGGGGG + Intergenic
999514093 5:152283524-152283546 ATTTTGCCCCTAATGGAGGTAGG + Intergenic
999702360 5:154239569-154239591 ATTTTTCCACGGATGGGGACCGG - Intronic
999725711 5:154435651-154435673 ATTTTTCCACGGTTGGGGGTGGG - Intergenic
999761823 5:154707619-154707641 ATTTTTCCACAGCTGGGGTGGGG + Intergenic
1000392457 5:160739133-160739155 ATTTTACCATAAATGGAAGTTGG - Intronic
1000606294 5:163331119-163331141 ATTTTTGCACAGGTGGTGTTAGG + Intergenic
1000749864 5:165081217-165081239 ATTATTCCACAGGTGGAGCAAGG + Intergenic
1001538138 5:172514131-172514153 ATTTTTCCACAGCCAGAGTTGGG - Intergenic
1001728008 5:173924086-173924108 ATGTTTCTACAGATGGAGGAAGG - Intronic
1001853799 5:174993164-174993186 AGCTTTCCTCAGATGGAGGTTGG + Intergenic
1001968057 5:175927862-175927884 ATTTTTATCAAGATGGAGGTTGG - Intronic
1002142259 5:177149596-177149618 GTTTTTCCACAGGTGGGAGTGGG + Intronic
1002195643 5:177499559-177499581 ATTTTTCCACAGACTGGGGGTGG - Intergenic
1002249387 5:177915944-177915966 ATTTTTATCGAGATGGAGGTTGG + Intergenic
1003165952 6:3678527-3678549 ATTTTAACACAAATGGTGGTTGG - Intergenic
1003167733 6:3695975-3695997 ATTGTTCCCCAGCTGGAGGAAGG - Intergenic
1003303372 6:4904884-4904906 ATTATTTCTCAGCTGGAGGTCGG - Intronic
1003913955 6:10768040-10768062 ATTTTTCTACAGATGGTGATAGG - Intronic
1003948456 6:11096178-11096200 ATTTTTCCACAGACGGAGCAGGG + Intronic
1004373756 6:15074599-15074621 ATTTTTCCACAGATGGAGGGTGG + Intergenic
1004441293 6:15657582-15657604 ATTTTTCCAGAAATACAGGTAGG + Intronic
1004949762 6:20655696-20655718 ATTTTTCCACAGACCGGGGGTGG - Intronic
1005086819 6:22015397-22015419 ATTTTTCCACGGATGGCGGTGGG - Intergenic
1005283288 6:24298053-24298075 ATTTCTCCACAGACGGAGTGGGG + Intronic
1005527498 6:26665321-26665343 AATTTTCCACAGATGGTGGAGGG - Intergenic
1006200729 6:32287484-32287506 ATTTTTACGCTGATGGGGGTTGG + Intergenic
1006214535 6:32429055-32429077 ATTTTGCCATGGATGGGGGTTGG + Intergenic
1006237311 6:32645310-32645332 ATTTTTCCACAGATAGTTGGGGG + Intronic
1006507496 6:34498934-34498956 GTTTTTCCACAGACTGGGGTTGG + Intronic
1006512822 6:34530783-34530805 ATTTTTCCACGGATGGGAGCGGG + Intronic
1006725997 6:36199345-36199367 ATTTTTCCACAGATGAGGGTGGG - Intronic
1008001515 6:46365163-46365185 ATTTTTCTACAGATGGGGTGAGG - Intronic
1008483540 6:52010946-52010968 ATTTTTTCACAGTTGGAATTAGG - Intronic
1008523902 6:52388443-52388465 ATTTTTCCACGTATGGGGGCTGG - Intronic
1008694139 6:54014414-54014436 ATTTTTCCACAGATGGGGCTAGG + Intronic
1008836713 6:55841159-55841181 ATTTTTCCATGGATGCAGGGTGG - Intronic
1008967487 6:57327851-57327873 ATTTTTCCACGGACTGAGGTCGG + Intronic
1009052195 6:58289653-58289675 GTTTTTCCACAGACTGGGGTTGG + Intergenic
1009405725 6:63310087-63310109 AGTTTTGTACAGATGGAGATAGG - Intronic
1010240188 6:73608157-73608179 ATTGCTACACAGATGGGGGTGGG - Intronic
1010287950 6:74101172-74101194 ATTTTTCCACATTAGGAGGGAGG + Intergenic
1010877149 6:81120763-81120785 ACTTTTCCACAGATGGGGTGTGG - Intergenic
1011569914 6:88724546-88724568 ATTTTTCCACAGACAGGGGAAGG + Intronic
1011571870 6:88746495-88746517 ATTTTTCCACAAATGTTGGTGGG + Intronic
1011752623 6:90468560-90468582 ATTTTTCCACATATGGGGTATGG - Intergenic
1011814528 6:91172990-91173012 TTTTTTCCACAGAGGGTGGCTGG + Intergenic
1011920809 6:92575311-92575333 ATTTTTTCAGGGGTGGAGGTGGG + Intergenic
1012758787 6:103268450-103268472 AGTTTTCCCCAAATGGAGATAGG - Intergenic
1013465818 6:110416038-110416060 ATTTTTCCACAGACTGGGGATGG + Intergenic
1014010436 6:116469413-116469435 ATTTTTCCACAGACAGGGGTGGG + Intergenic
1014527590 6:122519456-122519478 ATTTTTCCACAGACGGAGGTGGG - Intronic
1014592883 6:123294454-123294476 ATTTTTCCACAGCCTGGGGTCGG + Intronic
1014744995 6:125190486-125190508 GTTTTTCCACAGACGAAGGTTGG + Intronic
1014747504 6:125217209-125217231 ATTTTTCCACAGACAAAGGGTGG + Intronic
1015135767 6:129868222-129868244 ATTTTTCCCCAGTTGGAGCCTGG - Intergenic
1015230720 6:130912167-130912189 ATTTTTCCACATACCGGGGTGGG - Intronic
1015465584 6:133544779-133544801 ATTTTTCCACAGATGGGGGCGGG - Intergenic
1015508508 6:134014116-134014138 ATTTTTCCACAGACGGGGGCAGG + Intronic
1015553885 6:134440919-134440941 ATTTTTCCACAGATGGGACTGGG - Intergenic
1015819579 6:137246025-137246047 GTTTTTCCACAGATGAGGGCAGG + Intergenic
1016663007 6:146602884-146602906 ATTTTTCCATGGATGGAGAGGGG - Intronic
1017055820 6:150434733-150434755 ATATTTCCATGGATGGAGGTGGG - Intergenic
1017097299 6:150815929-150815951 ATTTTTCCACGGATGGAGGCAGG + Intronic
1017207546 6:151819772-151819794 ATTTTTCCACAGATGGAACTGGG - Intronic
1017260106 6:152376021-152376043 ATTTTTCCACAGATGGGGTGGGG + Intronic
1017318229 6:153057583-153057605 ATTTTTCCACGGATGGGTGTGGG + Intronic
1017324050 6:153126996-153127018 ATTTTTCCACGGATGGCAGTGGG + Intronic
1017804360 6:157930721-157930743 ATTTTTCCACAGATAGACAGTGG - Intronic
1018045860 6:159965770-159965792 ATTTTTCCATGGATGGTGGAGGG - Intergenic
1019721779 7:2576752-2576774 ATTTGTCCACAGATAAAGATTGG + Intronic
1019940075 7:4282767-4282789 ATTAATCCCCTGATGGAGGTGGG - Intergenic
1020187653 7:5971096-5971118 ATTTTTCCATGGATTGGGGTCGG + Intergenic
1020295264 7:6753674-6753696 ATTTTTCCATGGATTGGGGTCGG - Intergenic
1020727264 7:11831758-11831780 AGTCTTCCACAGATAGAGGGTGG + Exonic
1020780264 7:12509057-12509079 ACTTTTCCACAGACTGAGGAAGG - Intergenic
1021000508 7:15324652-15324674 ATTTTCCCACAGATGGTGGGGGG + Intronic
1021062829 7:16134411-16134433 ATTTTTCCATGGACAGAGGTCGG - Intronic
1021243802 7:18237084-18237106 CTTTTTCCACTGGTGCAGGTTGG + Intronic
1023199700 7:37682992-37683014 ATTTTTCCACAGACAGGGGTGGG - Intergenic
1023728770 7:43170358-43170380 ATTTTTCCACAGACAGGGGTGGG - Intronic
1025104907 7:56162808-56162830 ATTTTTCCACGGATGGGGGTTGG - Intergenic
1026149563 7:67776416-67776438 ATTTTTCCAAGGATGGGGTTGGG + Intergenic
1026314053 7:69212477-69212499 ATTTTTCCACAGATAAGGGGTGG - Intergenic
1026593210 7:71713622-71713644 ATTTCTCCAGAACTGGAGGTGGG + Intergenic
1026742549 7:72988226-72988248 ATTTTTCAACGAATGGGGGTGGG - Intergenic
1026802401 7:73408622-73408644 ATTTTTCAACGAATGGGGGTGGG - Intergenic
1027101186 7:75376852-75376874 ATTTTTCAACGAATGGGGGTGGG + Intergenic
1027398751 7:77786178-77786200 ATTTTTCCACGGACAGGGGTTGG + Intergenic
1027482725 7:78718779-78718801 ATTTTTCCACGGACAGGGGTTGG - Intronic
1027613554 7:80392804-80392826 TTTTTTCCACGGATTGGGGTGGG + Intronic
1027747000 7:82088832-82088854 ATTTTTCCACAAATGGAGGTGGG + Intronic
1028348672 7:89816428-89816450 ATTTTTCCACAGATGGGGGCAGG + Intergenic
1028479812 7:91292460-91292482 ATTTTTCCACAGATTGGGGTAGG - Intergenic
1028613194 7:92734965-92734987 ATTGTTCCACAGCTTGGGGTAGG + Intronic
1029140085 7:98403009-98403031 TTTTTTGCAGAGATGGGGGTGGG - Intergenic
1029321956 7:99770129-99770151 AGTTTTCCACTGGTGAAGGTTGG + Exonic
1029598903 7:101552435-101552457 ATTTTTATAGAGATGGGGGTGGG - Intronic
1030479263 7:110081879-110081901 ATTTTTCCATGGATGGGGGCAGG + Intergenic
1030625046 7:111835764-111835786 ATTTTTCAACAGAAGCAGCTGGG + Intronic
1031089602 7:117338609-117338631 GTTGTTCCACAGATGAAGATTGG - Intergenic
1031126076 7:117774624-117774646 ATTTTTCCATGGTTGGGGGTGGG - Intronic
1031223949 7:119010566-119010588 ATTTTTCCACAAATGAAGGTGGG + Intergenic
1031240768 7:119236546-119236568 CTTTTTCCAGAGATGGAGGAAGG - Intergenic
1031854751 7:126908379-126908401 ATGTTTCCACTCACGGAGGTTGG - Intronic
1032058528 7:128704207-128704229 GTCTTTCCACAGATGGAGGGTGG + Intergenic
1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG + Intergenic
1032195009 7:129783416-129783438 GTTTTTCCTCTGATCGAGGTAGG + Intergenic
1032540312 7:132697494-132697516 CTTTTTCCCCAGAGGCAGGTAGG + Intronic
1033135425 7:138780212-138780234 GTTTTTCCACGAATGGAGGTTGG + Intronic
1033848295 7:145462692-145462714 ATTGTTCCACATAAGGAGGCTGG + Intergenic
1033853102 7:145521962-145521984 ATTTTTCCACAGATGGGTTGTGG - Intergenic
1034360019 7:150486997-150487019 TTTTTTTCAGAGATGGAGGCAGG + Intergenic
1036578596 8:10052378-10052400 TTTTTTCCACAGATGGGGAAGGG - Intergenic
1036617627 8:10400767-10400789 ACTTTTCAACAGATGGTGCTGGG + Intronic
1037376501 8:18235743-18235765 ATTTGTCCAAAGCTGGAAGTGGG + Intergenic
1037376705 8:18238167-18238189 ATTTTTCCATGGATGGGGTTAGG + Intergenic
1037706030 8:21315950-21315972 ATCTATGCACAGATTGAGGTTGG - Intergenic
1037742525 8:21618959-21618981 GTTTTTCCACAGATGGGGTGAGG - Intergenic
1038032973 8:23661091-23661113 ATTTTTCCACAGATGGTGGGGGG + Intergenic
1038195055 8:25359727-25359749 ATTTTTCCACGGATGGGGGCAGG - Intronic
1038863597 8:31414498-31414520 ATTTTTCCATGGATGTGGGTGGG + Intergenic
1039586041 8:38707930-38707952 ATTTTTACACAGAAGGCGGAGGG - Intergenic
1040763086 8:50874305-50874327 ATTTTTCCACTGCTGGAGCTGGG + Intergenic
1040808467 8:51422312-51422334 ATTTTTCCACTGACCGGGGTGGG - Intronic
1040907451 8:52483280-52483302 ATTTTTCCACAGACCAAGGGTGG + Intergenic
1041281569 8:56215427-56215449 ATTTTTCCACGGATGGGGAAGGG + Intronic
1041351226 8:56949910-56949932 ATTTTTCCACAGACTAAGGCAGG - Intergenic
1041483130 8:58345150-58345172 AATTTTCCACAGATGGGGTGGGG + Intergenic
1041819099 8:62009418-62009440 ATTTTTCCAGGGATTGAGGTGGG + Intergenic
1041835661 8:62210428-62210450 ATTTTTCCACAGAGTGGGGATGG - Intergenic
1042378250 8:68081127-68081149 ATTTTTCCACAGGCGGAGGGTGG + Intronic
1042910842 8:73824599-73824621 ATTTTTCCATGGATGGGGTTGGG + Intronic
1043005579 8:74814352-74814374 ATTTTTCCACAGACGAGGGAGGG + Intronic
1043866829 8:85384163-85384185 ATTTTTCCACAGACCGACGTGGG - Intronic
1044064953 8:87687945-87687967 CCTTTTCCACAGATGGGGGTTGG + Intergenic
1044075429 8:87816170-87816192 ATTTCTCCACTGATAGAGGCTGG + Intergenic
1044416416 8:91945186-91945208 ATTTTTCCACAGACCAGGGTAGG + Intergenic
1045229783 8:100292963-100292985 ATTTTTCCACAGATGGAGGTGGG + Intronic
1045531509 8:102989437-102989459 ATTCTTCCACACATGGTGGTAGG - Intergenic
1045676558 8:104614348-104614370 AGTTTTCCACAGATTGGAGTGGG + Intronic
1045946715 8:107804881-107804903 GTTTTTCCACAGATGGGGTGGGG + Intergenic
1045980834 8:108185363-108185385 ACTGTTTCACAGATGGCGGTGGG + Intergenic
1046062682 8:109157974-109157996 ATTTTTCTACAGATGGTGAGGGG + Intergenic
1046349335 8:112985975-112985997 GTTTTTCCACAGATCGGGGGTGG - Intronic
1046638807 8:116702860-116702882 ATTTTTCCATAGAAGGTTGTGGG + Intronic
1047532433 8:125689163-125689185 ATTTTTCAACACATGGACTTTGG + Intergenic
1047559921 8:125975791-125975813 CTTTCTCCACAGATGGGGATGGG + Intergenic
1048071832 8:131029366-131029388 ATTTTTCCACAGACATGGGTGGG - Intronic
1048429927 8:134360746-134360768 ATTTTTCCATGGATAGTGGTCGG + Intergenic
1048583441 8:135750138-135750160 ATTTTTCCACAGATGGTGGAAGG - Intergenic
1048949602 8:139484730-139484752 ATTTTTCCAAAAATGTAGTTAGG + Intergenic
1050127632 9:2375836-2375858 AGTTTTCCACAGATGGTGGGTGG + Intergenic
1051378608 9:16431727-16431749 ATTTTTCCACAGATGTGAGTAGG + Intronic
1051434550 9:17016961-17016983 ATTTTTCGAAAGAGGGAGGGAGG - Intergenic
1051689606 9:19696237-19696259 GTTTTTCCACAGACCGAGGTTGG - Intronic
1052189490 9:25642079-25642101 ATTTTTCCACAAATGGGGGATGG + Intergenic
1052597749 9:30582300-30582322 ATTTTTCCACACACAGAGGGTGG + Intergenic
1052811403 9:33063794-33063816 ATTTTTCCACAGATGGTGGTGGG - Intronic
1052884915 9:33635827-33635849 ATTTTTCAACAAATGGTGATGGG + Intergenic
1052990299 9:34515043-34515065 ATTTTTCCTTAGATGGAGCCGGG - Intronic
1054699946 9:68403445-68403467 ATTTTTCCACAGACTGGGGGAGG - Intronic
1055057871 9:72040115-72040137 ATTTTCCCACGGAGTGAGGTGGG + Intergenic
1055409979 9:76018577-76018599 ATTTTTCCACGGATGTGGGGTGG - Intronic
1055501879 9:76909433-76909455 AATGTTCCAGAGATGGAGCTTGG - Intergenic
1055517086 9:77044196-77044218 ATTTTTTCAGAGATGGAACTGGG + Intergenic
1055602148 9:77931064-77931086 ATTTTTCCAGGGATGGGGGTCGG - Intronic
1055767882 9:79684599-79684621 ATTTTTCCATGGACGGAGGTGGG - Intronic
1055793376 9:79947553-79947575 ATCTCTACACAGATGGAGTTTGG - Intergenic
1055846375 9:80568553-80568575 ATTTTTCCACAGACCAGGGTGGG + Intergenic
1055965561 9:81862030-81862052 ACTCTGCCACAGATGGGGGTGGG + Intergenic
1055968250 9:81886367-81886389 CTCTTTCCACAAATGGTGGTGGG - Intergenic
1056593754 9:87987752-87987774 AGTTTTCCACGGATGGAAGTAGG - Intergenic
1056958122 9:91098909-91098931 GTTTTTCCATGGATGGGGGTAGG - Intergenic
1057586332 9:96331954-96331976 ATTTTTCCATGGATGCAGGATGG - Intronic
1057597134 9:96424087-96424109 ACCTTTCCACAGATGGAGAGAGG - Intergenic
1058014544 9:100015734-100015756 ATTTTTCCACTGATCAGGGTGGG + Intronic
1059361844 9:113749658-113749680 ATTCTTCCACACATGGCAGTGGG - Intergenic
1059870701 9:118570929-118570951 ATTTTTGCAGAGATGGAGCCTGG - Intergenic
1059976228 9:119720238-119720260 ACTTTTCCAGAGATGAAGGCAGG - Intergenic
1059985322 9:119815302-119815324 ATTTTTCATTTGATGGAGGTGGG - Intergenic
1060333950 9:122704153-122704175 TTTTTTCCACGGATGGTGGGAGG - Intergenic
1060344705 9:122806047-122806069 ATTTTTCCATGGACAGAGGTGGG - Intronic
1060345958 9:122815998-122816020 ATTTTTCCACAGACTGGGGTTGG + Intronic
1060605568 9:124910897-124910919 GTTTTTCCACAGATGGGGTCAGG - Intronic
1060711047 9:125864380-125864402 ATTTTTCCATGAATGGGGGTGGG + Intronic
1060874382 9:127070067-127070089 GTTTTTCCACGGATGGAGAGTGG + Intronic
1061467589 9:130794143-130794165 ATTTTTCCACAGACTGGGGATGG - Intronic
1061523362 9:131136469-131136491 ATGTTTCCACAGACAGGGGTTGG - Intronic
1061844220 9:133377730-133377752 ATTTTTCCACAGATGGAGGCGGG + Intronic
1062051212 9:134448019-134448041 ATTTTTCCTTTGTTGGAGGTTGG + Intergenic
1062305390 9:135903639-135903661 ATCTTTACACAAATGGAGGATGG + Intronic
1185728139 X:2439480-2439502 ATTTTTCCACTGATGTGGGGTGG + Intronic
1185985338 X:4826530-4826552 ATTTTTCCATGGATGAAGGTTGG + Intergenic
1186050215 X:5584474-5584496 ATTTTTCCACAGACAGGGGTGGG + Intergenic
1186160205 X:6769432-6769454 ATTAATCCACAGAGGCAGGTGGG + Intergenic
1186760475 X:12717340-12717362 GTTTTTCCAGAAATGGGGGTGGG - Intronic
1186996709 X:15131400-15131422 TTTTTTCCACAGACGGGGGGTGG - Intergenic
1187013874 X:15307368-15307390 ATTTTTCCACAGATGAGGGTGGG + Intronic
1187386251 X:18851368-18851390 ATTTTTCCACAGACTGGGGTCGG - Intergenic
1187865466 X:23719546-23719568 ATTTTTCCACGGAATGGGGTGGG + Intronic
1187909121 X:24094082-24094104 ATTTTTTCACAGATAGGGGGTGG - Intergenic
1188283932 X:28305112-28305134 GTTTTTCCACAGATGTGGGAAGG + Intergenic
1190951561 X:55150285-55150307 ATTTTTCCACAGATGGGGGAAGG + Intronic
1191686118 X:63892558-63892580 ATGTTTGCACTGATGGGGGTAGG - Intergenic
1192040379 X:67613888-67613910 ATTTTGCCACACATTCAGGTAGG - Intronic
1192156313 X:68749171-68749193 ATTTTTCCACAGATGAGGCCTGG - Intergenic
1192407523 X:70901485-70901507 ATTTTTCCACGGATGGTGGGGGG + Intronic
1193324410 X:80162594-80162616 ATTTCTCCACAGATGGAGTGGGG - Intergenic
1193365180 X:80623256-80623278 ATTTTTCCCCTGCTGGAGCTGGG - Intergenic
1193595438 X:83439392-83439414 ATTTTTCCCCTGCTGGTGGTGGG - Intergenic
1193669655 X:84368782-84368804 TTTTTTCCACGGATGAGGGTGGG + Intronic
1194278890 X:91922722-91922744 ATTTTTCCATGGACAGAGGTAGG - Intronic
1194580217 X:95662736-95662758 ATTTTTCTACATTTGGTGGTGGG - Intergenic
1194786223 X:98087311-98087333 ATTTTTCCACAAATGGTTGGGGG + Intergenic
1195124306 X:101790289-101790311 ATTTTTCCACCGATGGGGTGTGG - Intergenic
1195639980 X:107162801-107162823 ATTTTTCCACAGATGGCGGGAGG + Intronic
1195928400 X:110049356-110049378 ATTTTTCCATGGACTGAGGTGGG + Intronic
1197008182 X:121529375-121529397 ATTTTTCTACAGATGGGGGCAGG - Intergenic
1197442663 X:126510721-126510743 ATTTTTCCATGGACTGAGGTGGG - Intergenic
1197808840 X:130423155-130423177 ATTTTTCCACAAATGGGGGTGGG - Intergenic
1197840874 X:130745037-130745059 ATTTTTCCACAGACTGAGTCGGG - Intronic
1198270898 X:135055377-135055399 ATTTTTCCATGGATGGGGCTGGG + Intergenic
1198271297 X:135058766-135058788 ATTTTTCCAAGGATGGGGGTTGG - Intergenic
1198491518 X:137146096-137146118 TTTCTTCCAAAGATGGTGGTAGG - Intergenic
1200254182 X:154570664-154570686 AGTTTTCCACAGACGGGGATGGG + Intergenic
1200263587 X:154633744-154633766 AGTTTTCCACAGACGGGGATGGG - Intergenic
1200596368 Y:5146223-5146245 ATTTTTCCATGGAGAGAGGTAGG - Intronic
1200825297 Y:7632245-7632267 ATTTTTCCACAGATCATGGGTGG + Intergenic
1200834391 Y:7718639-7718661 TGTTTTCCATAGATGGAGGGTGG - Intergenic
1201241862 Y:11965119-11965141 ATTTTTCCACAGACAGGGTTGGG + Intergenic
1201901537 Y:19049140-19049162 GTACTTCCAGAGATGGAGGTGGG + Intergenic
1201943977 Y:19490761-19490783 ATTTTTCCACAGACAGAGGAGGG + Intergenic
1202202602 Y:22369112-22369134 ATTTTTCCACAGATAATGGGTGG - Intronic
1202234759 Y:22698841-22698863 ATTTTTCCACAGATCATGGGTGG - Intergenic
1202308400 Y:23497327-23497349 ATTTTTCCACAGATCATGGGTGG + Intergenic
1202562401 Y:26173259-26173281 ATTTTTCCACAGATCATGGGTGG - Intergenic