ID: 921152505

View in Genome Browser
Species Human (GRCh38)
Location 1:212413626-212413648
Sequence TGCCAGACCCTAGGTGGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921152505 Original CRISPR TGCCAGACCCTAGGTGGGTT AGG Intronic
900320513 1:2081339-2081361 GGCCAGACACTGGGTGGGTTGGG + Intronic
900579277 1:3400514-3400536 TGGCAGCTCCTAGGTGGGTTTGG + Intronic
906299877 1:44674201-44674223 TGCCAGACCCTATGAGGGGGCGG + Intronic
912005150 1:104890273-104890295 TGCCAGATCCTAGGAAGGGTAGG + Intergenic
915513569 1:156400308-156400330 TGCCAGCCCCTATGTGGCTGAGG - Intergenic
916883784 1:169047520-169047542 TGCCAGAACCTCCGTGGGTCTGG - Intergenic
918296775 1:183164581-183164603 TGCCTGACCCAAGGTGGGGGCGG + Intergenic
919159230 1:193806922-193806944 TGCCCAACCCTGGGTGGATTGGG - Intergenic
921152505 1:212413626-212413648 TGCCAGACCCTAGGTGGGTTAGG + Intronic
922753039 1:228079934-228079956 TGCCAGGCCTGAGGTGGGCTGGG + Intergenic
1063126809 10:3142888-3142910 AGCCAGACTCTGGGTGGGTGGGG - Intronic
1063374487 10:5545941-5545963 TCCCAGTCCCTGGGTGGCTTGGG + Intergenic
1067472380 10:46546453-46546475 TGCCAGACCCCAGCAGGGATGGG - Intergenic
1067495300 10:46756152-46756174 GACCAGACCCTAGGAGGGTGGGG - Intergenic
1067599354 10:47584236-47584258 GACCAGACCCTAGGAGGGTGGGG + Intergenic
1067949014 10:50710822-50710844 GACCAGACCCTAGGAGGGTGGGG + Intergenic
1069677755 10:70260591-70260613 TGCCAGGCCCTAGTTGGCTCAGG + Intronic
1069872080 10:71539312-71539334 TGCCAGGCTATAGGTGGGCTGGG - Intronic
1070884332 10:79875828-79875850 GACCAGACCCTAGGAGGGTGGGG + Intergenic
1071525173 10:86354220-86354242 AGCCAGACCATGGGTGGGCTGGG + Intronic
1076785063 10:132745609-132745631 TGTCAGACCCTGGGTGTGGTGGG + Intronic
1078855696 11:15204972-15204994 TGCCTGAGCCTTGCTGGGTTTGG + Intronic
1082085406 11:48045710-48045732 TCCCAGACCCTTGTTGGGTCAGG + Intronic
1083147028 11:60767553-60767575 TGCCAAAGCCTAGGTGGATGAGG - Exonic
1084452890 11:69250615-69250637 GGCCAGCCCCGAGGTGGGTGAGG + Intergenic
1084462963 11:69306519-69306541 GGCCAGACCCAAGGTTGGCTAGG - Intronic
1087318134 11:96628773-96628795 TGCCAGAGACTGGGTGGGGTGGG + Intergenic
1089764255 11:120751555-120751577 TGCCAGGCTCTGGGTGGGTTTGG + Intronic
1090829358 11:130410190-130410212 TCACAGACCCTAGGTTGGTGAGG - Intronic
1091262268 11:134244089-134244111 TGCCAGGCCCTTGGAGGGTTGGG + Intronic
1092560704 12:9610332-9610354 AGCAAGACCTTAGGTGGATTGGG + Intergenic
1096222792 12:49842598-49842620 GGCCAGACCCCAGGTGGGAACGG - Intronic
1100758052 12:97773784-97773806 TGGCAGCCCCTAGGTAGCTTTGG - Intergenic
1101649164 12:106659217-106659239 AGCCAGACCCCAGCTGGGCTAGG - Intronic
1102014298 12:109637657-109637679 TGCCGAACCCTGGGTGGGCTTGG + Intergenic
1103008793 12:117441879-117441901 ACCCAGACCCCACGTGGGTTGGG + Intronic
1103963649 12:124624708-124624730 TTCCCGACCCTTGGTGGGTAGGG - Intergenic
1104388829 12:128374513-128374535 TGCCAGGCAGTGGGTGGGTTTGG + Intronic
1110724322 13:78802101-78802123 TGCCAGACACTAGGGTGGTTAGG - Intergenic
1111915632 13:94357255-94357277 TTCCAAACCCTTAGTGGGTTTGG + Intronic
1120854524 14:89201348-89201370 TGCCAGACTCTAGAGGGCTTCGG - Intronic
1122200079 14:100117181-100117203 TGCGAGGCCCTAGCTGGGGTGGG - Intronic
1122254864 14:100469168-100469190 TGCCAGACCCTAGGAGAGGCAGG - Intronic
1128886886 15:71296327-71296349 TGCCAGACCTCAGGTGGGTAGGG - Intronic
1132580106 16:680749-680771 AGCCAGACCCTCGGTGGGGCCGG - Intronic
1132623210 16:878024-878046 AGCCAGACCCCATGTGTGTTTGG - Intronic
1133403987 16:5508704-5508726 TGCCATACCCAAGGTGGGGCGGG + Intergenic
1138598327 16:58041211-58041233 TGCCAGCCCCGAGGAGGGCTCGG - Intronic
1138957749 16:61991832-61991854 TTCCAGTCTCTGGGTGGGTTGGG - Intronic
1143636238 17:8165117-8165139 AGCCACAGCCTAGGTGGGGTGGG - Intergenic
1145007831 17:19347577-19347599 AGCCACACACCAGGTGGGTTGGG - Intronic
1146230791 17:31107155-31107177 TCCCAGACCCAAGGTGGGACAGG - Intronic
1146471765 17:33130597-33130619 TCCCAGACTCTTGGGGGGTTGGG - Intronic
1147958710 17:44153005-44153027 TTCCAGGCCCTGGGTGGGGTGGG + Intronic
1148163055 17:45462552-45462574 TCCCACCCCCTAGCTGGGTTAGG + Intronic
1149840564 17:59961118-59961140 TGCCTGACCCCAGGTGGTTGGGG - Intronic
1150394284 17:64809207-64809229 TCCCACCCCCTAGCTGGGTTAGG + Intergenic
1160590856 18:79944020-79944042 TCCCAGACTCCAGGTGGGGTAGG + Intronic
1166729751 19:45052443-45052465 TGCCAGACCCGAGCTGGCTCAGG + Intronic
1167646194 19:50706430-50706452 TGCCACGGCCTAGGAGGGTTAGG + Intronic
1168369640 19:55821494-55821516 TGCCATCCCCTAGTTGGGTTAGG - Intronic
926119663 2:10235162-10235184 TGCCAGGCCCCAGGGGGATTAGG - Intergenic
932754236 2:74394857-74394879 TGCCAGGCCTCAGGTGGGATGGG + Intergenic
932824890 2:74930200-74930222 TGGCAGACCCCAGGGTGGTTAGG + Intergenic
933195400 2:79383655-79383677 TGCCGAGCCCTAGGTGGTTTTGG + Intronic
935737461 2:106117773-106117795 TGACAGGCCCTAGGGGAGTTAGG - Intronic
936064642 2:109321366-109321388 TGCCAAAGCCTATGTGGATTAGG + Intronic
936885764 2:117308866-117308888 TGCCACACCCTAGGTGGTGCTGG + Intergenic
941299934 2:163788269-163788291 TGGCAGCCCCTAGGTGGCATCGG - Intergenic
1170242655 20:14186075-14186097 TGTCAGAAGCTAGCTGGGTTGGG - Intronic
1171847333 20:30284999-30285021 TGCCAGGGCCTTGGAGGGTTGGG - Intergenic
1173333990 20:42098384-42098406 AGCCAAGCCCTAGGTGGGTCAGG - Intronic
1174548683 20:51345416-51345438 TGCCATTCCCTGAGTGGGTTGGG - Intergenic
1175539547 20:59739781-59739803 AGGCCCACCCTAGGTGGGTTGGG - Intronic
1175730490 20:61350543-61350565 TGCCTGACCCTGGGTGGGAGAGG - Intronic
1175919275 20:62442468-62442490 TGCAGGCCCCCAGGTGGGTTAGG + Intergenic
1175919879 20:62445867-62445889 TGGAGGACCCTAGGTGGGGTGGG + Intergenic
1177267337 21:18801649-18801671 TGCCAGCCCCTAGGTGGCATAGG + Intergenic
1177584151 21:23068318-23068340 TGGCAGACACTAGGTTGGATTGG - Intergenic
1179284611 21:39966770-39966792 TGCCACAGCCTGGGTGGGATTGG + Intergenic
1179418937 21:41220443-41220465 TGGCAGCCCCTAGGTAGCTTCGG - Intronic
1179480118 21:41671670-41671692 TGCCAGATCCTGTGGGGGTTTGG + Intergenic
1181681281 22:24497504-24497526 TGCCTGACCCTGGGTGGGAGAGG + Intronic
1182012171 22:27010199-27010221 TGCCAAACCCCAGTTGTGTTTGG + Intergenic
1185372355 22:50466805-50466827 TGACAGACCCGAGGTGGGACTGG + Intronic
950212165 3:11131752-11131774 TGCCAGTCCCTGGGTTGGGTTGG + Intergenic
950447413 3:13046378-13046400 TGCCAGTCCCTAGCTGGCTCAGG + Intronic
950644391 3:14368378-14368400 TGGCAGCCCCCAGGTGGGGTGGG - Intergenic
954374793 3:50188605-50188627 TGCCAGCCCCTGCCTGGGTTGGG + Exonic
958049153 3:88322100-88322122 TTACAGACCCCAGGAGGGTTAGG - Intergenic
962947021 3:140181101-140181123 TGGCAGAGCCTATGTGAGTTTGG - Intronic
966810329 3:183838103-183838125 TGCCTGAGCCTAGGAGGGTGAGG - Intronic
975408401 4:74018814-74018836 TGCCAGACCCTGCCTGGCTTTGG + Intergenic
978638450 4:110840033-110840055 TGCCAGTGCCTTGGTGGGTGGGG - Intergenic
990247443 5:53877135-53877157 TGCAAGAGCTGAGGTGGGTTGGG - Intergenic
991164855 5:63553833-63553855 TGCCAGACACTTGGTTAGTTTGG - Intergenic
992997510 5:82347591-82347613 TTCCTGACACTGGGTGGGTTGGG - Intronic
995401612 5:111748515-111748537 TGCCAGATCCTAGTTAGGTATGG + Intronic
996746462 5:126850602-126850624 TGCCTGACCCTGGTTGGGGTGGG + Intergenic
997600410 5:135134874-135134896 TGTCACACCCTGTGTGGGTTGGG - Intronic
1001419710 5:171577379-171577401 TGCCAGACCCTGGCTGAGCTGGG - Intergenic
1001981646 5:176041869-176041891 AGCCAGACACTAGCTGGGTGCGG - Intergenic
1002235822 5:177802196-177802218 AGCCAGACACTAGCTGGGTGCGG + Intergenic
1004187121 6:13430504-13430526 TGCCATACCCTATGTGGCTCGGG - Intronic
1005618057 6:27594166-27594188 TGGCAGAGCCCAGGTGAGTTAGG + Intergenic
1007813369 6:44502493-44502515 TGCACGACCCCAGGTGGGTCTGG - Intergenic
1009645637 6:66396748-66396770 TGGCTCACCCTAGGTGGGTGTGG + Intergenic
1009927317 6:70135415-70135437 TGGCAGCCCCTAGGTAGCTTCGG - Intronic
1012867349 6:104634000-104634022 TGCCACACCCTAGGTCAGTAAGG + Intergenic
1014972525 6:127835248-127835270 TCCCAGGCCCTAGGTGATTTTGG + Intronic
1015466703 6:133556307-133556329 TGCCAGAGGCTAGGTGGATGGGG - Intergenic
1019181353 6:170188925-170188947 TGCCAGACCCAAGCTGGGGCAGG + Intergenic
1019602755 7:1893518-1893540 TGCCAGCCCCCAGGTGGAGTGGG + Intronic
1024956581 7:54927136-54927158 CCCCAGGCCCTAGGTGGGTCTGG - Intergenic
1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG + Intronic
1027644472 7:80779967-80779989 TGCCAAAAACCAGGTGGGTTTGG + Intronic
1028524535 7:91769013-91769035 TGCCAGACCATTGGTGGGTGGGG + Intronic
1033218366 7:139510727-139510749 TGCCAGAACCAACGTGGGTTAGG + Intergenic
1034164215 7:149013265-149013287 TGCCAGGCCCCAGCTGGGTGTGG - Intronic
1034781000 7:153882783-153882805 TGGCAGACCCTATGGGGCTTAGG + Intergenic
1034873589 7:154705558-154705580 TGACACACCCTGGGTGGGTCAGG - Intronic
1038135983 8:24786310-24786332 TGCCAGGCCCTGTGTGGGTGGGG + Intergenic
1043197174 8:77310585-77310607 TACCACACACTAGGTGGCTTAGG + Intergenic
1043786561 8:84408607-84408629 TTCAAGAACCCAGGTGGGTTGGG + Intronic
1045331745 8:101161489-101161511 TGGCAGCCCCTAGGTAGCTTTGG + Intergenic
1047354501 8:124107616-124107638 TGCCAGAGCCTAGGTATGTCAGG + Intronic
1055316520 9:75039668-75039690 TACCTGACCCTAGGTTGATTAGG - Intergenic
1055930030 9:81550677-81550699 TGCCAGAGGCTAGGGGTGTTGGG - Intergenic
1056574111 9:87842280-87842302 GACCAGACCCTAGGAGGGTGGGG - Intergenic
1056755101 9:89376823-89376845 TGCCAGGCCACAGGTGAGTTGGG - Exonic
1057701308 9:97365034-97365056 TGCCAGACCCCAGGCGGTTCAGG + Intronic
1058169268 9:101660137-101660159 TGCCCCAGCCTAGGTGGTTTTGG - Intronic
1059295873 9:113270116-113270138 TTCCAGCCCCCAGCTGGGTTAGG - Intronic
1060297013 9:122349842-122349864 TGCCAGCTCCTAGCTGGGTGAGG + Intergenic
1061759919 9:132843506-132843528 TGCCAGACCCTAATTGCATTAGG - Intronic
1189467601 X:41289114-41289136 GGCCAGGCCCTAGGTGTGTGTGG + Intergenic
1195201544 X:102554796-102554818 TGGCAGCCCCTAGGTAGCTTCGG - Intergenic
1195332850 X:103819923-103819945 TGCCATAACCTTGGGGGGTTAGG - Intergenic
1199184260 X:144896611-144896633 TACCAGAGCCTAAGGGGGTTGGG + Intergenic