ID: 921157371

View in Genome Browser
Species Human (GRCh38)
Location 1:212449153-212449175
Sequence CCTAGAGCCCCACAGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921157371_921157385 19 Left 921157371 1:212449153-212449175 CCTCCCAGCTGTGGGGCTCTAGG No data
Right 921157385 1:212449195-212449217 TGAAGAAGGAGGGAGGACGTTGG No data
921157371_921157380 8 Left 921157371 1:212449153-212449175 CCTCCCAGCTGTGGGGCTCTAGG No data
Right 921157380 1:212449184-212449206 CCACCCTGGGATGAAGAAGGAGG No data
921157371_921157377 -5 Left 921157371 1:212449153-212449175 CCTCCCAGCTGTGGGGCTCTAGG No data
Right 921157377 1:212449171-212449193 CTAGGGCTTCATGCCACCCTGGG No data
921157371_921157384 12 Left 921157371 1:212449153-212449175 CCTCCCAGCTGTGGGGCTCTAGG No data
Right 921157384 1:212449188-212449210 CCTGGGATGAAGAAGGAGGGAGG No data
921157371_921157378 5 Left 921157371 1:212449153-212449175 CCTCCCAGCTGTGGGGCTCTAGG No data
Right 921157378 1:212449181-212449203 ATGCCACCCTGGGATGAAGAAGG No data
921157371_921157386 20 Left 921157371 1:212449153-212449175 CCTCCCAGCTGTGGGGCTCTAGG No data
Right 921157386 1:212449196-212449218 GAAGAAGGAGGGAGGACGTTGGG No data
921157371_921157387 30 Left 921157371 1:212449153-212449175 CCTCCCAGCTGTGGGGCTCTAGG No data
Right 921157387 1:212449206-212449228 GGAGGACGTTGGGAGAGCGCAGG No data
921157371_921157381 9 Left 921157371 1:212449153-212449175 CCTCCCAGCTGTGGGGCTCTAGG No data
Right 921157381 1:212449185-212449207 CACCCTGGGATGAAGAAGGAGGG No data
921157371_921157376 -6 Left 921157371 1:212449153-212449175 CCTCCCAGCTGTGGGGCTCTAGG No data
Right 921157376 1:212449170-212449192 TCTAGGGCTTCATGCCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921157371 Original CRISPR CCTAGAGCCCCACAGCTGGG AGG (reversed) Intergenic
No off target data available for this crispr