ID: 921157374

View in Genome Browser
Species Human (GRCh38)
Location 1:212449156-212449178
Sequence AGCCCTAGAGCCCCACAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921157374_921157384 9 Left 921157374 1:212449156-212449178 CCCAGCTGTGGGGCTCTAGGGCT No data
Right 921157384 1:212449188-212449210 CCTGGGATGAAGAAGGAGGGAGG No data
921157374_921157385 16 Left 921157374 1:212449156-212449178 CCCAGCTGTGGGGCTCTAGGGCT No data
Right 921157385 1:212449195-212449217 TGAAGAAGGAGGGAGGACGTTGG No data
921157374_921157378 2 Left 921157374 1:212449156-212449178 CCCAGCTGTGGGGCTCTAGGGCT No data
Right 921157378 1:212449181-212449203 ATGCCACCCTGGGATGAAGAAGG No data
921157374_921157389 29 Left 921157374 1:212449156-212449178 CCCAGCTGTGGGGCTCTAGGGCT No data
Right 921157389 1:212449208-212449230 AGGACGTTGGGAGAGCGCAGGGG No data
921157374_921157376 -9 Left 921157374 1:212449156-212449178 CCCAGCTGTGGGGCTCTAGGGCT No data
Right 921157376 1:212449170-212449192 TCTAGGGCTTCATGCCACCCTGG No data
921157374_921157381 6 Left 921157374 1:212449156-212449178 CCCAGCTGTGGGGCTCTAGGGCT No data
Right 921157381 1:212449185-212449207 CACCCTGGGATGAAGAAGGAGGG No data
921157374_921157386 17 Left 921157374 1:212449156-212449178 CCCAGCTGTGGGGCTCTAGGGCT No data
Right 921157386 1:212449196-212449218 GAAGAAGGAGGGAGGACGTTGGG No data
921157374_921157390 30 Left 921157374 1:212449156-212449178 CCCAGCTGTGGGGCTCTAGGGCT No data
Right 921157390 1:212449209-212449231 GGACGTTGGGAGAGCGCAGGGGG No data
921157374_921157377 -8 Left 921157374 1:212449156-212449178 CCCAGCTGTGGGGCTCTAGGGCT No data
Right 921157377 1:212449171-212449193 CTAGGGCTTCATGCCACCCTGGG No data
921157374_921157380 5 Left 921157374 1:212449156-212449178 CCCAGCTGTGGGGCTCTAGGGCT No data
Right 921157380 1:212449184-212449206 CCACCCTGGGATGAAGAAGGAGG No data
921157374_921157388 28 Left 921157374 1:212449156-212449178 CCCAGCTGTGGGGCTCTAGGGCT No data
Right 921157388 1:212449207-212449229 GAGGACGTTGGGAGAGCGCAGGG No data
921157374_921157387 27 Left 921157374 1:212449156-212449178 CCCAGCTGTGGGGCTCTAGGGCT No data
Right 921157387 1:212449206-212449228 GGAGGACGTTGGGAGAGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921157374 Original CRISPR AGCCCTAGAGCCCCACAGCT GGG (reversed) Intergenic
No off target data available for this crispr