ID: 921157384

View in Genome Browser
Species Human (GRCh38)
Location 1:212449188-212449210
Sequence CCTGGGATGAAGAAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921157371_921157384 12 Left 921157371 1:212449153-212449175 CCTCCCAGCTGTGGGGCTCTAGG No data
Right 921157384 1:212449188-212449210 CCTGGGATGAAGAAGGAGGGAGG No data
921157370_921157384 15 Left 921157370 1:212449150-212449172 CCTCCTCCCAGCTGTGGGGCTCT No data
Right 921157384 1:212449188-212449210 CCTGGGATGAAGAAGGAGGGAGG No data
921157374_921157384 9 Left 921157374 1:212449156-212449178 CCCAGCTGTGGGGCTCTAGGGCT No data
Right 921157384 1:212449188-212449210 CCTGGGATGAAGAAGGAGGGAGG No data
921157375_921157384 8 Left 921157375 1:212449157-212449179 CCAGCTGTGGGGCTCTAGGGCTT No data
Right 921157384 1:212449188-212449210 CCTGGGATGAAGAAGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921157384 Original CRISPR CCTGGGATGAAGAAGGAGGG AGG Intergenic
No off target data available for this crispr