ID: 921159739

View in Genome Browser
Species Human (GRCh38)
Location 1:212464429-212464451
Sequence AGGAAGGCAGGTGCTACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921159739_921159748 -2 Left 921159739 1:212464429-212464451 CCATGTGTAGCACCTGCCTTCCT No data
Right 921159748 1:212464450-212464472 CTGGTAGCCGGGGCGGCTTCAGG No data
921159739_921159745 -9 Left 921159739 1:212464429-212464451 CCATGTGTAGCACCTGCCTTCCT No data
Right 921159745 1:212464443-212464465 TGCCTTCCTGGTAGCCGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921159739 Original CRISPR AGGAAGGCAGGTGCTACACA TGG (reversed) Intergenic
No off target data available for this crispr