ID: 921162115

View in Genome Browser
Species Human (GRCh38)
Location 1:212480420-212480442
Sequence CAGCTCAGAGAACTTCCGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921162108_921162115 24 Left 921162108 1:212480373-212480395 CCAATCATGCCTGCATAGTGGAT No data
Right 921162115 1:212480420-212480442 CAGCTCAGAGAACTTCCGGTTGG No data
921162109_921162115 15 Left 921162109 1:212480382-212480404 CCTGCATAGTGGATCTCCCATAA No data
Right 921162115 1:212480420-212480442 CAGCTCAGAGAACTTCCGGTTGG No data
921162110_921162115 -1 Left 921162110 1:212480398-212480420 CCCATAAAAACCCTAGAGAACAC No data
Right 921162115 1:212480420-212480442 CAGCTCAGAGAACTTCCGGTTGG No data
921162111_921162115 -2 Left 921162111 1:212480399-212480421 CCATAAAAACCCTAGAGAACACA No data
Right 921162115 1:212480420-212480442 CAGCTCAGAGAACTTCCGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921162115 Original CRISPR CAGCTCAGAGAACTTCCGGT TGG Intergenic
No off target data available for this crispr