ID: 921163338

View in Genome Browser
Species Human (GRCh38)
Location 1:212488176-212488198
Sequence CCCCCGTCCTGGCCCTCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921163327_921163338 30 Left 921163327 1:212488123-212488145 CCTTTGTCTCCTCTCCTGTAAGG No data
Right 921163338 1:212488176-212488198 CCCCCGTCCTGGCCCTCCACAGG No data
921163333_921163338 16 Left 921163333 1:212488137-212488159 CCTGTAAGGTCATGGAGGAGGTG No data
Right 921163338 1:212488176-212488198 CCCCCGTCCTGGCCCTCCACAGG No data
921163330_921163338 21 Left 921163330 1:212488132-212488154 CCTCTCCTGTAAGGTCATGGAGG No data
Right 921163338 1:212488176-212488198 CCCCCGTCCTGGCCCTCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921163338 Original CRISPR CCCCCGTCCTGGCCCTCCAC AGG Intergenic
No off target data available for this crispr