ID: 921163821

View in Genome Browser
Species Human (GRCh38)
Location 1:212491628-212491650
Sequence CAGTTCCCATTTCGGATATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921163821_921163825 11 Left 921163821 1:212491628-212491650 CCTTATATCCGAAATGGGAACTG No data
Right 921163825 1:212491662-212491684 TCACATGTGAGTTTAACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921163821 Original CRISPR CAGTTCCCATTTCGGATATA AGG (reversed) Intergenic
No off target data available for this crispr