ID: 921165522

View in Genome Browser
Species Human (GRCh38)
Location 1:212504111-212504133
Sequence GCCCAGAGCCAGTGTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921165522_921165528 6 Left 921165522 1:212504111-212504133 CCCTGCCCACACTGGCTCTGGGC No data
Right 921165528 1:212504140-212504162 ATGAGATTTGTTTTGGCCAATGG No data
921165522_921165526 -1 Left 921165522 1:212504111-212504133 CCCTGCCCACACTGGCTCTGGGC No data
Right 921165526 1:212504133-212504155 CTTGACCATGAGATTTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921165522 Original CRISPR GCCCAGAGCCAGTGTGGGCA GGG (reversed) Intergenic
No off target data available for this crispr