ID: 921166548

View in Genome Browser
Species Human (GRCh38)
Location 1:212512144-212512166
Sequence GAGGCTCACCAACGGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921166548_921166556 9 Left 921166548 1:212512144-212512166 CCTGTGTCCCGTTGGTGAGCCTC No data
Right 921166556 1:212512176-212512198 AGATTAAAGAAGGAGTCAACAGG No data
921166548_921166557 29 Left 921166548 1:212512144-212512166 CCTGTGTCCCGTTGGTGAGCCTC No data
Right 921166557 1:212512196-212512218 AGGATCTGAGAAAGAGCCAGAGG No data
921166548_921166555 -1 Left 921166548 1:212512144-212512166 CCTGTGTCCCGTTGGTGAGCCTC No data
Right 921166555 1:212512166-212512188 CATGGGGCTAAGATTAAAGAAGG No data
921166548_921166558 30 Left 921166548 1:212512144-212512166 CCTGTGTCCCGTTGGTGAGCCTC No data
Right 921166558 1:212512197-212512219 GGATCTGAGAAAGAGCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921166548 Original CRISPR GAGGCTCACCAACGGGACAC AGG (reversed) Intergenic
No off target data available for this crispr