ID: 921166666

View in Genome Browser
Species Human (GRCh38)
Location 1:212513057-212513079
Sequence GGTCTAAGCAGATCCACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921166664_921166666 -4 Left 921166664 1:212513038-212513060 CCCGTGGCGCGTAGTGTGAGGTC No data
Right 921166666 1:212513057-212513079 GGTCTAAGCAGATCCACTGCAGG No data
921166665_921166666 -5 Left 921166665 1:212513039-212513061 CCGTGGCGCGTAGTGTGAGGTCT No data
Right 921166666 1:212513057-212513079 GGTCTAAGCAGATCCACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921166666 Original CRISPR GGTCTAAGCAGATCCACTGC AGG Intergenic
No off target data available for this crispr