ID: 921171125

View in Genome Browser
Species Human (GRCh38)
Location 1:212550845-212550867
Sequence TAGCTCACTGTAGCTTGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921171121_921171125 5 Left 921171121 1:212550817-212550839 CCCAGGCTGGAGTGCAATTTTGC 0: 7
1: 219
2: 14891
3: 85218
4: 177114
Right 921171125 1:212550845-212550867 TAGCTCACTGTAGCTTGAATTGG No data
921171122_921171125 4 Left 921171122 1:212550818-212550840 CCAGGCTGGAGTGCAATTTTGCC No data
Right 921171125 1:212550845-212550867 TAGCTCACTGTAGCTTGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921171125 Original CRISPR TAGCTCACTGTAGCTTGAAT TGG Intergenic
No off target data available for this crispr