ID: 921174605

View in Genome Browser
Species Human (GRCh38)
Location 1:212583296-212583318
Sequence GCTCATAGTGCACTACACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 63}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921174602_921174605 9 Left 921174602 1:212583264-212583286 CCCAGGCTGGTGCAGTGGCTGTT 0: 1
1: 0
2: 8
3: 43
4: 464
Right 921174605 1:212583296-212583318 GCTCATAGTGCACTACACTCTGG 0: 1
1: 0
2: 0
3: 6
4: 63
921174603_921174605 8 Left 921174603 1:212583265-212583287 CCAGGCTGGTGCAGTGGCTGTTC 0: 1
1: 0
2: 7
3: 32
4: 311
Right 921174605 1:212583296-212583318 GCTCATAGTGCACTACACTCTGG 0: 1
1: 0
2: 0
3: 6
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921174605 Original CRISPR GCTCATAGTGCACTACACTC TGG Intronic
900600722 1:3501651-3501673 GCTCACAGTGCACTCCCCTGGGG - Intronic
905409653 1:37759715-37759737 GATCATAGTGCATTACAGCCTGG - Intronic
908501838 1:64751660-64751682 AATCATAGTGCACTGCACTGTGG + Intronic
909253618 1:73390124-73390146 GCTCTTAGTGCATTACAGCCTGG + Intergenic
915549136 1:156622481-156622503 GATCACAGTGCACTACAGTGTGG + Intronic
916308133 1:163362877-163362899 ACTAAGAGTGCACTACACACAGG + Intergenic
919642748 1:200061247-200061269 ACTCAGAGTGCACAACATTCGGG + Intronic
919673561 1:200359788-200359810 GATCATAGTACACTACAGCCTGG - Intergenic
921174605 1:212583296-212583318 GCTCATAGTGCACTACACTCTGG + Intronic
924726115 1:246672559-246672581 GATCATAGTTCACTGCAGTCTGG - Intergenic
1065160258 10:22912322-22912344 GCTCATTGTGTACTTGACTCCGG - Intergenic
1070068360 10:73060505-73060527 GATCATGGTGCACTACAGCCTGG - Intronic
1073800030 10:107031667-107031689 AATCATAGTGCACTACAGGCTGG + Intronic
1077236098 11:1482668-1482690 TCTCACAGTGCACTAAGCTCCGG - Intronic
1078311241 11:10245343-10245365 GGTCATTGTGCACTATAGTCTGG - Intronic
1078667029 11:13334284-13334306 GCCCATGGTGCACTAGACTTGGG + Intronic
1084501036 11:69535577-69535599 GATCATAGTTCACTACAGCCTGG + Intergenic
1091233171 11:134001546-134001568 GCTCATAGTACACTGGACACTGG - Intergenic
1091671205 12:2453468-2453490 CCACAGAGTGCACTACACGCTGG - Intronic
1107909808 13:45095218-45095240 GATCATAGCTCACTACAGTCTGG - Intergenic
1113228841 13:108190090-108190112 ACTCATAGTGCCTCACACTCAGG - Intergenic
1115218720 14:31037884-31037906 GATCATAGCTCACTACACCCTGG - Intronic
1117181074 14:53192299-53192321 GCTACTAGTGCACTGCAGTCTGG - Intergenic
1121489047 14:94344792-94344814 GCTCCTATTCCACTGCACTCAGG - Intergenic
1121826705 14:97016127-97016149 GCTGATAGGGCAAAACACTCAGG - Intergenic
1134818113 16:17222893-17222915 GCTCTTCGTGAACCACACTCAGG + Intronic
1141892965 16:86939518-86939540 GATCATAGTGCCCTCCACCCTGG - Intergenic
1153264885 18:3260583-3260605 GATCATAATGCACTACAACCTGG - Intergenic
1155468112 18:26161670-26161692 GATCATAGTGCACTACAGCCTGG - Intronic
1168286041 19:55334080-55334102 GTGCAAAGTGCACTAGACTCTGG + Intergenic
930012076 2:46945166-46945188 TCTCATAGTTCACTTCACCCTGG + Intronic
938773997 2:134525135-134525157 TCTTATAGTTCACTACACACAGG - Intronic
941257877 2:163256424-163256446 GTTCAGAGTGCTCTTCACTCAGG + Intergenic
942964917 2:181880418-181880440 GGTCTTAGTGCACTACTCTAAGG - Intergenic
944311383 2:198237414-198237436 GATCATAGTGCACCACAGCCTGG + Intronic
1172084027 20:32364599-32364621 GATCATAGTGCACTAGAGCCTGG + Intronic
1174998574 20:55600461-55600483 TCTCTGAGTGCACTGCACTCAGG - Intergenic
1181576845 22:23800692-23800714 GCTCATAGTGCAGTACACCATGG + Intronic
952114984 3:30168302-30168324 GCTCAAAGAGCACTGCACTAAGG + Intergenic
957045504 3:75370990-75371012 GGTCATAGGCCACCACACTCAGG + Intergenic
960130981 3:114056209-114056231 GCTCCTAGAGCATTTCACTCAGG + Intronic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
962550947 3:136491181-136491203 GATCATAGTTCACTGCACCCTGG + Intronic
965307015 3:167078504-167078526 GCACATAATGCACTAAACTCAGG - Intergenic
972954845 4:44376443-44376465 GTTCAAAGTGCATTACTCTCTGG - Intronic
975803825 4:78091721-78091743 GGTCATAGTGCCCTACAGCCCGG + Intronic
975836272 4:78425322-78425344 GCTCATAGTGCAATAGAAGCAGG + Intronic
977202733 4:94136081-94136103 CATCATAGTGCACTACAGCCTGG - Intergenic
978649968 4:110990324-110990346 ATTCATAGTGCACTAGACTGAGG - Intergenic
993745014 5:91586459-91586481 GCTCAAAGTGCACCACAGGCAGG + Intergenic
994317937 5:98356070-98356092 CCTCATAGTGCACAATACTGTGG - Intergenic
995513368 5:112929818-112929840 GATCATAGCTCACTGCACTCTGG - Intergenic
1003463777 6:6357421-6357443 GCCCAGAGTGCATTACACCCTGG + Intergenic
1005581596 6:27240464-27240486 GCTCAAAGTGCAAAACACTCTGG - Intergenic
1006805313 6:36784617-36784639 GCTCAGAGAGCACGACTCTCAGG - Intronic
1013020900 6:106216809-106216831 GATCATAGTGCAGTACAGCCTGG - Intronic
1013239054 6:108225972-108225994 AATCATAGTTCACTACAGTCTGG - Intronic
1014443493 6:121499817-121499839 GATCACAGCGCACTCCACTCTGG - Intergenic
1016340321 6:143054971-143054993 GCTCATAGTGGACTGCAGTTGGG - Intergenic
1024181707 7:46901744-46901766 AGTGATAGTGCATTACACTCTGG - Intergenic
1032457141 7:132081810-132081832 GCTCAGACTGCACTTTACTCTGG - Intergenic
1036080661 8:5552125-5552147 GATCGTAGTGCACTACAGCCTGG + Intergenic
1036409311 8:8484084-8484106 GATCATAGTGCACTACAGCCTGG - Intergenic
1036913837 8:12785526-12785548 CCCCACAGTGCCCTACACTCTGG - Intergenic
1041684855 8:60634050-60634072 GATCATAGCTCACTACAGTCTGG - Intergenic
1047452673 8:124979824-124979846 GGTGCTAGTGCACTACAGTCTGG - Intergenic
1055257191 9:74385545-74385567 GCTCAAAGTGCAGAACTCTCTGG + Intergenic
1056519499 9:87387101-87387123 GATCATAGTACACTACAGCCTGG - Intergenic
1193332315 X:80248751-80248773 GATAATAGTGCACTCCATTCAGG + Intergenic
1196749510 X:119102442-119102464 GATCATAGTGCACTACAGCCTGG + Intronic