ID: 921174788

View in Genome Browser
Species Human (GRCh38)
Location 1:212584614-212584636
Sequence GCATTTAAACTGATGGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921174788 Original CRISPR GCATTTAAACTGATGGATCA AGG (reversed) Intronic
900876529 1:5346679-5346701 GAATTTAAACTAATGTTTCATGG + Intergenic
908368846 1:63458938-63458960 GCAATATAACTGATGAATCATGG - Intronic
908629942 1:66092718-66092740 GCATTTAAGCTGAGAGATGAAGG + Intronic
908952640 1:69580031-69580053 GCATTTAGAGTGATTGTTCATGG - Intronic
909351339 1:74656574-74656596 GCATTTTACTTGATGGATAATGG - Intronic
909731481 1:78896982-78897004 GCATTTAAACAGAGTGATGAGGG - Intronic
911818795 1:102389349-102389371 GCATTTAAACTGATAATTAAAGG + Intergenic
912012754 1:104989794-104989816 GAATTTAAACAGAGGTATCAAGG + Intergenic
912312501 1:108637872-108637894 GAGTGTAAACTGATGGCTCAGGG - Exonic
913710249 1:121475858-121475880 TCATGTTAACTGATGAATCAGGG - Intergenic
919069495 1:192735781-192735803 GCATATAAACTAATGAAACAGGG + Intergenic
919405728 1:197180630-197180652 GCTATAAAACAGATGGATCAAGG - Intronic
919598010 1:199588699-199588721 AAATTTAAACTGATATATCAAGG - Intergenic
920786716 1:209049560-209049582 GCATTTAAACTGAAGCTTCATGG - Intergenic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
923452742 1:234135082-234135104 GCATTTAAACAGGCTGATCAGGG + Intronic
924447835 1:244150248-244150270 GCTGTTGAACTGATGGATGAGGG - Intergenic
1063074007 10:2696146-2696168 GCAATTGATCTCATGGATCAAGG - Intergenic
1064661387 10:17611390-17611412 GCATTTAAACTGAGCGGTGAAGG - Intronic
1065914619 10:30343513-30343535 GCTATGAAACTGATGGATCAAGG + Intronic
1066232131 10:33446109-33446131 GCATATAAACTGAAGGATGATGG - Intergenic
1068502005 10:57851458-57851480 GAAATAAAACTGCTGGATCATGG - Intergenic
1069281941 10:66665613-66665635 GCATTGAAACAGATGGGTCGGGG - Intronic
1069922180 10:71822466-71822488 CCATTTAAAATGATGCATTAAGG + Intronic
1072450452 10:95535389-95535411 GCAATTAAACTGATAAACCAAGG + Intronic
1073527311 10:104196206-104196228 TCATTTAAACTGCTGGATTGAGG + Intronic
1074367527 10:112871250-112871272 GCATTTGAACTGGTGGACCCAGG + Intergenic
1086367777 11:86125402-86125424 GCATTTAAAGTCATGGAACTGGG + Intergenic
1087768281 11:102179870-102179892 TCATTTAAACTGAAGGGACAGGG - Intronic
1088410348 11:109527043-109527065 GCATTTTAACTTCTGAATCAGGG - Intergenic
1088427220 11:109716969-109716991 TCATTTGAATTGATGTATCAAGG - Intergenic
1088772515 11:113049383-113049405 CCTTTGAAACTCATGGATCAAGG + Intronic
1092995686 12:13948287-13948309 GCATTTAAACATATGGGGCAGGG - Intronic
1095673494 12:44889373-44889395 GCTTTTGAACTGATGACTCATGG - Intronic
1096854646 12:54471717-54471739 TCATTTAAACTTATGCATGAGGG + Intronic
1101619659 12:106372639-106372661 GCATTTAAAGTTATGGATATTGG - Intronic
1101900085 12:108785445-108785467 GCATGTAAACAGATGGCACATGG - Exonic
1109646117 13:65259651-65259673 GCATCTAAACTGAGGCAGCAGGG + Intergenic
1110017822 13:70430616-70430638 CTATTTCAACTGATGTATCATGG + Intergenic
1110368105 13:74710161-74710183 GTATTTAAACTGATGTGTCATGG + Intergenic
1110522484 13:76497064-76497086 GCTTTTAAACTGATGTATAAAGG - Intergenic
1110698583 13:78520419-78520441 GCATTTAGACTCTTGGCTCATGG - Intergenic
1112946070 13:104928580-104928602 GAATTTACACTGAGGGATGATGG - Intergenic
1113716736 13:112514504-112514526 GCTTTTAAAATGATTGATGAGGG - Intronic
1119941235 14:78643839-78643861 GCCTTTAGAAAGATGGATCAAGG + Intronic
1120014186 14:79451486-79451508 CCAATTAAATAGATGGATCATGG + Intronic
1128536247 15:68492885-68492907 GCATGAACACTGATGGGTCACGG - Intergenic
1141168792 16:81678199-81678221 GCCTTTAGTCTGATGGGTCATGG + Intronic
1141244741 16:82295237-82295259 GCATCTAAACTGATGGAAAATGG + Intergenic
1146531260 17:33609507-33609529 GCATTTAACCTGATGCTTGAAGG - Intronic
1147491425 17:40870885-40870907 GAAATTAAACAAATGGATCATGG - Intergenic
1151798171 17:76360777-76360799 TCATTTTTACTGATGGGTCAGGG + Intronic
1153983885 18:10335893-10335915 ACATTGAAACAGATGGTTCAAGG - Intergenic
1155766767 18:29644472-29644494 GCATTTAAAATTGTGAATCATGG - Intergenic
1156951242 18:42900995-42901017 GCATTTTTACTGATGGTGCAAGG + Intronic
1158205340 18:54986472-54986494 GAATTTAAACTGTGGGATCAGGG - Intergenic
1158569764 18:58588194-58588216 CCATTTTTACTGATGCATCAAGG + Intronic
1159325304 18:66907607-66907629 GCATTTATTATGATGCATCAAGG + Intergenic
1162621821 19:11849550-11849572 GCAGGGAAAATGATGGATCAAGG + Intronic
1165168499 19:33873472-33873494 ACATTTAAGCTGATGGATTCAGG - Intergenic
925932154 2:8717007-8717029 GCAATTAAATGGATGGATAAAGG - Intergenic
926653675 2:15374460-15374482 TCATTTAAAATAATGGGTCAAGG + Intronic
929230626 2:39556355-39556377 GAATTTAAACTCACAGATCAAGG - Intergenic
929787790 2:45004599-45004621 GCAGTGAAACTGAAGGGTCAGGG - Intergenic
931099482 2:58979724-58979746 GCATGTAAAGTGATGAATTAAGG + Intergenic
936454531 2:112662147-112662169 GCATTTAAGCTGGTCCATCATGG + Intronic
940692744 2:156939793-156939815 GAATTTAAACTGAGGGAGCATGG - Intergenic
941654325 2:168126963-168126985 GCATTTGAAGGGATGGATGATGG + Intronic
943139842 2:183968504-183968526 GCATTTAAATAGATTGATAATGG + Intergenic
1169704833 20:8491342-8491364 AAATTTAAACTCATAGATCAAGG - Intronic
1170722738 20:18898166-18898188 GCATTTAAACACATGGATTTGGG - Intergenic
1172023096 20:31929116-31929138 GGATTCAAACTGTTGAATCAAGG - Intronic
1174615715 20:51833935-51833957 GGATTTAAACTCATGGATGTCGG - Intergenic
1175147460 20:56907690-56907712 TCATTTTGACTGGTGGATCAGGG - Intergenic
1179204463 21:39261532-39261554 ACATTTGTACTGATGGATCATGG - Intronic
1180569129 22:16699446-16699468 GCAATAAATCTCATGGATCATGG - Intergenic
1180885119 22:19237524-19237546 GAAATTAAACTGCTGGGTCAGGG - Intronic
1181051396 22:20239862-20239884 GCAGCTAAACTGCTGGATCTGGG - Intergenic
949618333 3:5781461-5781483 GCATTTGAATTGGTGGACCAAGG - Intergenic
950621203 3:14206971-14206993 GCCTTGAAACTGCTGGATGAAGG + Intergenic
952203545 3:31156183-31156205 GCATTCACACTGAGGGGTCAGGG - Intergenic
956204863 3:66744719-66744741 GCATTTTGAGTCATGGATCATGG - Intergenic
956871390 3:73421614-73421636 GCAGTTAAATTGAGGTATCAAGG - Intronic
957509742 3:81171887-81171909 GCATTTAACTTGATAGATCAGGG - Intergenic
963616178 3:147541269-147541291 ACACTTAAACATATGGATCAGGG - Intergenic
964851679 3:161102759-161102781 GCTTTTAACAGGATGGATCATGG - Intronic
964886140 3:161485182-161485204 CCATTTAGAATCATGGATCAAGG - Intergenic
966438943 3:179922127-179922149 GCTTGTAAGATGATGGATCATGG + Intronic
967094720 3:186167929-186167951 GCAATTGAACTGCAGGATCAAGG + Intronic
974460536 4:62181699-62181721 GCATTTAATCTGCTGAATCTAGG + Intergenic
975329350 4:73096998-73097020 GCAAACAAACTGATGGTTCAAGG - Intronic
983901027 4:173134433-173134455 GCAATTAAACTAATTCATCAGGG + Intergenic
985932799 5:3072318-3072340 ACATTAATACTGTTGGATCAGGG - Intergenic
987474910 5:18379033-18379055 GAATTTAAACTGAACCATCAGGG + Intergenic
988047033 5:25969643-25969665 TGATTTAATCTGATGCATCAGGG - Intergenic
989014532 5:36914306-36914328 GCCTTTAAACCTATGGATAATGG + Intronic
989987443 5:50717692-50717714 GCATAGAAACTGAGAGATCATGG + Intronic
991979121 5:72213158-72213180 GGATTTTAAATGCTGGATCAAGG - Intergenic
992243791 5:74796728-74796750 TCATTTATACTGAAGGACCATGG + Intronic
993351898 5:86859830-86859852 GCATTTAAGCTTATGGCTAATGG + Intergenic
993421255 5:87703522-87703544 GGAATTAAAGTAATGGATCAAGG + Intergenic
994436366 5:99738782-99738804 GTATTTGAACTGAAGAATCATGG + Intergenic
996007278 5:118436834-118436856 GCACTTAAACTGAACGATAAAGG - Intergenic
997614099 5:135234725-135234747 TCATTAAAACTGATGCCTCAGGG + Intronic
999423269 5:151463564-151463586 GCCTTTTAACAGGTGGATCAAGG - Exonic
1000276343 5:159738803-159738825 GCATTTCAAGTGATGGAGAAAGG + Intergenic
1003697386 6:8423839-8423861 GCATTTACACTGATGCATATGGG - Intronic
1004079459 6:12376969-12376991 GCATTGAAACTGGAGGATAAGGG + Intergenic
1006482011 6:34303035-34303057 GCATTTATATGGATGGATAAAGG - Intronic
1011010666 6:82700347-82700369 TCATTTAAACTTATAGGTCATGG - Intergenic
1012465640 6:99514279-99514301 GCATTTTCACTGATGGAGGAAGG - Intronic
1016046819 6:139489485-139489507 CCTTATAAAATGATGGATCAAGG - Intergenic
1017081409 6:150672422-150672444 GCATTTATATTGTTTGATCATGG + Intronic
1021432318 7:20574628-20574650 GAATTTAAAATGATACATCAAGG + Intergenic
1022688738 7:32623981-32624003 GAAGTGAAACTGATGGATCAAGG + Intergenic
1022916375 7:34958612-34958634 GAAGTGAAATTGATGGATCAAGG + Intronic
1022980364 7:35599897-35599919 GGATTAAAACTGATGGGTCATGG + Intergenic
1023484218 7:40666821-40666843 GATGTTAAAGTGATGGATCATGG + Intronic
1026347853 7:69490457-69490479 GCATTTAACTTGATGGATGGAGG - Intergenic
1027571774 7:79877100-79877122 GCAGTTAAAGTGATCGTTCATGG - Intergenic
1028279751 7:88907672-88907694 ACATTTAAAATGAGGGAGCATGG + Intronic
1029377876 7:100192222-100192244 GCATTTAAAATGGTGAATCCCGG + Intronic
1031832853 7:126648647-126648669 GCATTTATGCTTTTGGATCAGGG + Intronic
1033460116 7:141539276-141539298 TAATTTAAACAGATGGCTCAGGG + Intergenic
1037223019 8:16548485-16548507 GGATTTAAACTGGAGGAACAAGG + Intronic
1038811018 8:30843710-30843732 GCAATTCAACTAATTGATCATGG + Exonic
1038903753 8:31873968-31873990 ACATTTTCATTGATGGATCAAGG - Intronic
1040034112 8:42851940-42851962 GCATTTAAATGGATGGATGGTGG + Intronic
1041554401 8:59136282-59136304 GCATTTTGACTTTTGGATCACGG + Intergenic
1041620913 8:59968105-59968127 GCATTAAAAATGATGGATGTTGG - Intergenic
1042217806 8:66443889-66443911 GCTTTTACACTGATGGATGATGG - Intronic
1042657925 8:71120713-71120735 GCATTTAAACATATAGATCAAGG + Intergenic
1047812102 8:128422100-128422122 GCATTTAAACTGATGGTGGAAGG + Intergenic
1048829232 8:138459871-138459893 GGATTTAAACTGATGCATTCTGG - Intronic
1050122459 9:2321480-2321502 GGATTGAAACTCAGGGATCAGGG - Intergenic
1050958572 9:11696397-11696419 GCATTTGAGCTGTTGGTTCAAGG - Intergenic
1057484669 9:95473171-95473193 GCATTTAGGCAGATGGATAAAGG + Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1190135466 X:47792577-47792599 GCATTAAATATGAAGGATCAAGG + Intergenic
1194167328 X:90534267-90534289 GCATTGAAACTGCTGGTTCTTGG - Intergenic
1194942139 X:100023822-100023844 GCAGTGAAGCTGTTGGATCATGG - Intergenic
1200513591 Y:4112042-4112064 GCATTGAAACTGCTGGTTCTTGG - Intergenic
1200708039 Y:6459388-6459410 GCATTTCAAGTTGTGGATCATGG - Intergenic
1201026073 Y:9705320-9705342 GCATTTCAAGTTGTGGATCATGG + Intergenic