ID: 921176564

View in Genome Browser
Species Human (GRCh38)
Location 1:212600212-212600234
Sequence GACTGCTGGTAGAGGGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921176564 Original CRISPR GACTGCTGGTAGAGGGCTGA GGG (reversed) Intronic
901493734 1:9609673-9609695 GACTGCTGTCTGAGGGCTGCTGG - Intronic
902249608 1:15145604-15145626 CACTGTTGGTTGAGGGCTTATGG + Intergenic
902642325 1:17774801-17774823 AGCCGCTGGAAGAGGGCTGAGGG + Intronic
905265065 1:36746686-36746708 GACTGTGGGGAGAGGGGTGAGGG + Intergenic
906945084 1:50288552-50288574 GACTGTTGATAGTGGGATGAAGG - Intergenic
907414481 1:54304719-54304741 CACTGCTGGTGCAAGGCTGAGGG + Intronic
912682177 1:111736321-111736343 GAGCGCTGGGAGAAGGCTGAGGG - Intronic
915931339 1:160062460-160062482 GACTGCTGGTAGAGGGTGAGGGG + Intronic
916174162 1:162023852-162023874 GGCTGCTGGGCGAGGGCTGCTGG + Exonic
916842189 1:168612292-168612314 GACTCCAGGTAGTGGGTTGATGG + Intergenic
919770020 1:201152132-201152154 GAATGCGGGGAGAGGGATGAGGG + Intronic
920567920 1:206990564-206990586 GATTGCTGGTGCAGGGGTGAAGG - Intergenic
920578548 1:207082738-207082760 TTCTGCTTGTAAAGGGCTGAAGG - Intronic
920920625 1:210294697-210294719 GAGTGGAGATAGAGGGCTGATGG - Intergenic
921176564 1:212600212-212600234 GACTGCTGGTAGAGGGCTGAGGG - Intronic
924801071 1:247330146-247330168 TTCTGGTGGCAGAGGGCTGATGG + Intronic
1070271016 10:74955024-74955046 CAGTGGTGGTAGAGGGGTGAGGG - Intronic
1070314253 10:75295276-75295298 GACTGCAGGGAGAGGTGTGAGGG - Intergenic
1072513153 10:96149218-96149240 GACTGGTGATAGATGGCTTATGG + Intronic
1072519165 10:96215015-96215037 AACTGTGGGTTGAGGGCTGAGGG + Intronic
1072617622 10:97060040-97060062 GGGAGCTGGTACAGGGCTGACGG - Intronic
1075549295 10:123380155-123380177 GACCTCAGGTAGAGGGCTTATGG - Intergenic
1077864412 11:6210930-6210952 GGCTCCTGGTGGAGGGCTGCGGG - Exonic
1078800523 11:14640108-14640130 AAATGCTGGTAGAGGGGGGATGG + Intronic
1079711586 11:23690043-23690065 GAATGTTGGTAGTGAGCTGAAGG - Intergenic
1079844577 11:25448826-25448848 GAATTCAGGTAGGGGGCTGAGGG + Intergenic
1081160404 11:39741932-39741954 GAAGGGTGGTAGGGGGCTGAAGG + Intergenic
1084594118 11:70107028-70107050 GACTGGTGGATGAGGGCTGGTGG + Intronic
1084622026 11:70278859-70278881 GACAGCTGGTAGAGTGTTTAGGG + Intronic
1088214399 11:107491983-107492005 GACAGCAGGCATAGGGCTGAAGG - Intergenic
1088427436 11:109719762-109719784 GGCTGCTGGAAGAGGGCTACAGG - Intergenic
1092860518 12:12716288-12716310 GAATGCTTTCAGAGGGCTGAAGG - Intronic
1096115030 12:49050624-49050646 AGCTTCTGGTGGAGGGCTGATGG + Exonic
1096335285 12:50750719-50750741 CACTGGTGGTAAAGGGCAGAAGG - Intergenic
1098209480 12:68148683-68148705 GACTCCTGTGAGAGGGCTGTGGG - Intergenic
1100981660 12:100167000-100167022 GACTGGTGTCAGAGGGCTGTGGG - Intergenic
1101861175 12:108483624-108483646 GTCTGCTGGTTGCTGGCTGATGG + Intergenic
1103700285 12:122845649-122845671 GACTGCTGGGTGAGGGGAGAGGG + Intronic
1104114953 12:125740742-125740764 GACTCCTGGTAAAGGGGTGCGGG + Intergenic
1105923224 13:24984105-24984127 GACTGGTGTCTGAGGGCTGAGGG + Intergenic
1108004616 13:45934376-45934398 GGCTGCATGTAGATGGCTGAAGG + Intergenic
1109540721 13:63775789-63775811 GTCAGCAGGTAGGGGGCTGAGGG - Intergenic
1112752972 13:102600279-102600301 GACGGATGGTAGAAGCCTGACGG - Intronic
1116341098 14:43724133-43724155 TATTGCTGGCAGAGGGCTAAAGG + Intergenic
1117082197 14:52163675-52163697 GTCTGGAGGTAGGGGGCTGAGGG + Intergenic
1118321828 14:64757892-64757914 GAGAGCAGGAAGAGGGCTGAGGG - Intronic
1118410384 14:65471176-65471198 CACAGTTGGTAGAGGGCAGAGGG - Intronic
1119584014 14:75815121-75815143 GACTGCTGGGTGAGGGATGTAGG + Intronic
1122031576 14:98916160-98916182 CACTGCTGGGAGAGGGCTGGGGG - Intergenic
1124389941 15:29245866-29245888 GACTGCTGGCAAAGGTGTGAAGG + Intronic
1124431486 15:29612476-29612498 CTCTGCTGGTAGCAGGCTGAAGG - Intergenic
1126831475 15:52611668-52611690 GACTGCTGCTACAGCGATGATGG - Exonic
1126897210 15:53271879-53271901 GGTTGATGGTAGAGGGCAGAAGG + Intergenic
1128085886 15:64886455-64886477 GGCTGGCGGTAGAGGGCTGGGGG + Intronic
1128329289 15:66745285-66745307 GAGTGCGGGTAGGGGGCTCAGGG - Intronic
1128466711 15:67918647-67918669 TTCTGCTGGCAGAGGGCAGAAGG + Intergenic
1129291511 15:74571745-74571767 GATTGCTTTTAGAGGGTTGAAGG + Intronic
1130367868 15:83256890-83256912 GACCTCTGGTGCAGGGCTGAGGG + Exonic
1134328237 16:13226713-13226735 GTCTGCTGTTAGGTGGCTGATGG + Intronic
1138144412 16:54595861-54595883 GACTGCTGGTAGAGAATAGATGG - Intergenic
1140942211 16:79732828-79732850 CAATGTTGGTAGAGGGGTGAGGG - Intergenic
1141223699 16:82095048-82095070 GACTGATGGCAAAAGGCTGATGG + Intronic
1142102863 16:88284867-88284889 GCCAGCTGGTAGAGGACAGATGG - Intergenic
1142485653 17:246276-246298 GACGGCAGGCAGAGGGGTGAGGG - Intronic
1144807208 17:17976023-17976045 AACTCCTGGTGCAGGGCTGATGG - Intronic
1145007746 17:19347080-19347102 TGCTGCTGGAACAGGGCTGAAGG + Intronic
1147162868 17:38578250-38578272 GACTGCAGGCAGAGGTCTGGGGG + Intronic
1151696438 17:75720676-75720698 GACTGCTCTCAGAGGACTGACGG + Intergenic
1151706762 17:75773353-75773375 GACCGCTGGTGGTGGGCAGATGG + Intergenic
1155320291 18:24612295-24612317 GACTGGTGGTAGGGGGTGGAAGG + Intergenic
1156486712 18:37471125-37471147 TCCTGCTGGTGGAGGGCTGAAGG - Intronic
1161497661 19:4596444-4596466 GACAGCTGGCAGGGGACTGACGG + Intergenic
1162782721 19:13014862-13014884 GGCTGGTGGTAGGGGGCTGGTGG + Intronic
1163860238 19:19738976-19738998 GGCTGAGGGCAGAGGGCTGAAGG - Intergenic
1164537994 19:29100692-29100714 GAACGAGGGTAGAGGGCTGATGG - Intergenic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1165236562 19:34426733-34426755 TACTGCTGTTATGGGGCTGAAGG - Intergenic
1165904870 19:39187630-39187652 GCCTGCTGGTAGAGGGGGAAGGG - Intergenic
925345216 2:3167278-3167300 GGCTGCTGGTGTGGGGCTGAGGG + Intergenic
926040489 2:9668858-9668880 GACTCCTGGTTGGGGGCTGTTGG + Intergenic
927632746 2:24788485-24788507 GAGAGTTGGTAGAGTGCTGAGGG - Intergenic
929946845 2:46378136-46378158 GACTGCTGCCAGATGGCTGAAGG + Intronic
931457702 2:62425030-62425052 GGCTTCAGGCAGAGGGCTGAGGG - Intergenic
931702163 2:64918071-64918093 GACTCCTGATGGAGGGCTGGGGG + Intergenic
934054523 2:88240747-88240769 TGCTGCTGGTGGAGGGCTCAGGG - Intergenic
934726119 2:96620573-96620595 GATTGCTGGGAGTGGGGTGAAGG - Intronic
936000155 2:108819516-108819538 TTCTGCTGGAAGAGGTCTGAGGG + Intronic
937056991 2:118946320-118946342 GACTGCTGGTGGGGGAGTGAGGG - Intronic
941871961 2:170395198-170395220 GACTCCTTGTGGAGGGCTGGGGG + Intronic
941928408 2:170917669-170917691 TTCTGCTGGCAGAGGGCAGAGGG + Intergenic
942516783 2:176762396-176762418 CACTGCTGCTAGTGGGTTGAGGG - Intergenic
945400965 2:209382388-209382410 AACTCCTGGTAGGGGGATGAAGG + Intergenic
946490515 2:220144859-220144881 GGCTGGTGGTTTAGGGCTGAGGG + Intergenic
946676071 2:222161206-222161228 GCCTGCAGGCAGACGGCTGAGGG - Intergenic
947636416 2:231682809-231682831 GACTGGAGGCAGAGGGCTAAGGG - Intergenic
947986964 2:234456486-234456508 GACTGCTGGTATAGGGGTCAAGG + Intergenic
948309218 2:236972519-236972541 GGCTGCTGGCTGAGTGCTGAGGG - Intergenic
948372038 2:237495679-237495701 GACTGGTGGTCCAGGGCCGAGGG - Intronic
1169504972 20:6200113-6200135 GAGTGCAGGTAGAGAGTTGATGG - Intergenic
1172092948 20:32446574-32446596 GACTGCTGGGAGATGGCAGCCGG - Exonic
1172785370 20:37464981-37465003 GACTGTTGGTAGAGGGGTGGAGG - Intergenic
1177110646 21:17023679-17023701 AACTGCCTGTAGAGGGTTGAAGG - Intergenic
1177773145 21:25539450-25539472 CACTGCTTGTGGAGGGCAGAGGG - Intergenic
1178240174 21:30890369-30890391 GCCTACAGGTAGAGGGCTGCAGG + Intergenic
1178920519 21:36735490-36735512 CACTGCTGTGTGAGGGCTGAGGG + Intronic
1179103848 21:38380749-38380771 GACTGGGGGTGGAGGGTTGAGGG + Exonic
1179202235 21:39235789-39235811 GGGTGCTGGCATAGGGCTGATGG - Intronic
1179390352 21:40983357-40983379 GGCTGTTGGTTGAGGGGTGAGGG - Intergenic
1179469818 21:41603077-41603099 GGCTGCTGGGAGATGGGTGAAGG - Intergenic
1179583277 21:42358522-42358544 AGCTGCTGGTTCAGGGCTGAAGG + Intergenic
1184720350 22:46308991-46309013 GGCTTCTGTGAGAGGGCTGAGGG - Intronic
1184923220 22:47620240-47620262 CCCGCCTGGTAGAGGGCTGAGGG - Intergenic
1185272280 22:49935031-49935053 GACTGCCGTTTGAGGGGTGAGGG - Intergenic
950267412 3:11584895-11584917 GGGTGCTGGGAGAGGGCAGAAGG - Intronic
951062551 3:18226665-18226687 GACTGGGGGTAGATGACTGATGG - Intronic
952382519 3:32816550-32816572 GAGTGCTGGGAGGGGGCTGGGGG - Intergenic
952865819 3:37854528-37854550 CACTCCTGCTAGTGGGCTGAGGG + Intergenic
960977062 3:123185823-123185845 GAAGGGTAGTAGAGGGCTGAGGG - Intronic
961200981 3:125045181-125045203 GAATGCTGGCAGATGGCTGAAGG + Intronic
969166892 4:5323601-5323623 GACAGAGGGTAGAGGGTTGATGG - Intronic
970454048 4:16204144-16204166 GACTGCTGGTTCAGTACTGAGGG + Intronic
974295536 4:59994320-59994342 CTCTGCTGGTGGAGGGCAGAGGG + Intergenic
975448878 4:74501048-74501070 GACTGCAGGTGCAGGGTTGATGG + Intergenic
977377300 4:96222191-96222213 GTCTGCTGGTAGGAGGGTGATGG - Intergenic
981434961 4:144709526-144709548 CTCTGGTGGCAGAGGGCTGAAGG + Intronic
981849797 4:149216900-149216922 GAATGTTAGTAGAGGTCTGAAGG + Intergenic
984574531 4:181432433-181432455 GACTGCAGGGAGTGTGCTGATGG - Intergenic
986406310 5:7428148-7428170 AACTGCTGGTAGCAGGTTGATGG + Intronic
990951959 5:61307115-61307137 TACTCTAGGTAGAGGGCTGAGGG + Intergenic
992251203 5:74877422-74877444 AACTGGTGGTAGAGGGGTGGGGG - Intergenic
993218187 5:85053381-85053403 AACTGCTGGTAGGGAGCAGACGG - Intergenic
997536358 5:134625304-134625326 CACTGCTGGTGGAGGGTGGAAGG - Intronic
1000174303 5:158735747-158735769 GACTGCTTATAGAGGGCTTTAGG + Intronic
1001282401 5:170396210-170396232 CAATGTTGGTTGAGGGCTGAGGG + Intronic
1002682771 5:180981362-180981384 CACTGCTGGGAGAGGGAGGATGG + Intergenic
1002698829 5:181108620-181108642 GTCTTCTGGGAGAGGGGTGAAGG - Intergenic
1003400151 6:5784185-5784207 GACTGGTGTCTGAGGGCTGAGGG + Intergenic
1004056636 6:12145575-12145597 GACATCTGCTAGAGAGCTGAAGG - Intronic
1006021567 6:31120818-31120840 GACTGCGAGTGGAGGGCAGATGG - Intronic
1006422525 6:33944318-33944340 TACTGATGGCAGAGGGCTGCTGG - Intergenic
1006444860 6:34074462-34074484 GCCTCCTGGTAGGGGGCGGAAGG - Intronic
1007229709 6:40339771-40339793 AACTGCTGGAGGAGGGCTAACGG + Intergenic
1011930121 6:92701088-92701110 CACTGCTGGCAGAGGGCAGGAGG + Intergenic
1013591092 6:111620214-111620236 GCCTGCTGGCAGAGGCCTGGAGG - Intergenic
1014059051 6:117049924-117049946 TGCTGATGGGAGAGGGCTGAGGG + Intergenic
1015635447 6:135269916-135269938 CACTGGTGGTAGGGGGATGAAGG + Intergenic
1017361121 6:153573139-153573161 GCCTGCTGGTAGGGTTCTGAAGG - Intergenic
1019868676 7:3737499-3737521 GACTGCTGGCTGGGGACTGATGG + Intronic
1020797050 7:12688148-12688170 GACTGCTGGGAGACGGAAGAAGG - Exonic
1023817219 7:43960303-43960325 GACTGGGGGCAGAGGGATGAGGG + Intergenic
1023965542 7:44961641-44961663 GACTGAGGGCTGAGGGCTGAGGG + Intergenic
1024141801 7:46469424-46469446 GATTGCTGATAGAGGGATGTAGG + Intergenic
1026427201 7:70307689-70307711 GAGTGCTGGTAGAGGGATCTAGG - Intronic
1027402316 7:77821947-77821969 GATTGCAGGTGGAGAGCTGAGGG + Intronic
1028981452 7:96971799-96971821 TAGTGGTTGTAGAGGGCTGAGGG + Intergenic
1032416703 7:131741028-131741050 GCCTGCTGGGAGAGGGGAGACGG + Intergenic
1034231053 7:149528837-149528859 GACTACTGATAGAGGGATGCAGG - Intergenic
1036221667 8:6926107-6926129 GTCTGCTGGGAGAAGGCTCAGGG + Intergenic
1038467005 8:27773453-27773475 GCCTGCTGGTGGAGGGCGGTGGG + Intronic
1039719695 8:40150185-40150207 GACTGGTTGTAGAGTGCTGTTGG + Intergenic
1039838984 8:41280145-41280167 GAGTGCAGGGGGAGGGCTGACGG + Intronic
1042497250 8:69469283-69469305 CACAGCTGGTAGAATGCTGATGG - Intronic
1046961087 8:120113678-120113700 CTCTGATGGTAGCGGGCTGAGGG - Intronic
1049812753 8:144582793-144582815 GGCTGGTGGTGGAGGGCTGCAGG + Intronic
1050301033 9:4259313-4259335 GACTGCTAGTAGTGGACTGGGGG - Intronic
1051005015 9:12333872-12333894 CAATGCTTATAGAGGGCTGAAGG + Intergenic
1053556291 9:39140623-39140645 GACTGCTCGTAGAGAGCTGTAGG + Exonic
1053820402 9:41960877-41960899 GACTGCTCGTAGAGAGCTGTAGG + Exonic
1054110673 9:61104563-61104585 GACTGCTCGTAGAGAGCTGTAGG + Intergenic
1054610184 9:67226562-67226584 GACTGCTCGTAGAGAGCTGTAGG - Intergenic
1054734253 9:68734515-68734537 GACTGCTGGTAGCAGGCAGATGG + Intronic
1056904455 9:90633133-90633155 GGCGGCTTGTAGAGGGCAGAGGG + Intronic
1057161906 9:92895084-92895106 GACTGCTGCTGGAGGGCCCATGG + Intergenic
1057477333 9:95413921-95413943 GACTGCTGAGGGAGGGCTGAAGG - Intergenic
1062031791 9:134365146-134365168 GGCTGTTGCTGGAGGGCTGATGG + Intronic
1191183391 X:57585592-57585614 GACTGCTGCTTGAGGGCCTAGGG + Intergenic
1191213989 X:57916802-57916824 GACTGCTGCTTGAGGGCCTAGGG - Intergenic
1192343651 X:70283724-70283746 CAGTGCTGGTAGGGGGCAGAGGG - Intronic
1193915929 X:87363876-87363898 GAATGGTAGTAGAGTGCTGAGGG + Intergenic
1194914766 X:99691987-99692009 TACTACTGGTAGAGGGTGGAAGG + Intergenic
1197114497 X:122817390-122817412 CACTGCTGGTAGCCGGCAGATGG + Intergenic
1198619483 X:138490373-138490395 GACTGCAGATAAAGGGCTGAGGG + Intergenic
1199447603 X:147944135-147944157 GACTGTTGGGAGAGGGGTTAGGG - Intronic
1199698476 X:150360438-150360460 GACTGCAAGGAGAGGGTTGAAGG + Intergenic
1202109273 Y:21404747-21404769 GACTGCTGGAACTGGCCTGAGGG + Intergenic