ID: 921177720

View in Genome Browser
Species Human (GRCh38)
Location 1:212608575-212608597
Sequence GGCCGAAGGCGGGTGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 320}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921177720_921177741 25 Left 921177720 1:212608575-212608597 CCTCTCTCCACCCGCCTTCGGCC 0: 1
1: 0
2: 0
3: 21
4: 320
Right 921177741 1:212608623-212608645 CTTCCTCCGCTCCGTTCGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 47
921177720_921177737 21 Left 921177720 1:212608575-212608597 CCTCTCTCCACCCGCCTTCGGCC 0: 1
1: 0
2: 0
3: 21
4: 320
Right 921177737 1:212608619-212608641 CCCCCTTCCTCCGCTCCGTTCGG 0: 1
1: 0
2: 0
3: 14
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921177720 Original CRISPR GGCCGAAGGCGGGTGGAGAG AGG (reversed) Intronic
900152375 1:1184264-1184286 GGCCAAAAGCGGGAGGTGAGAGG - Intronic
900418626 1:2546209-2546231 GGCCGGGGGCGGGGGGAGCGGGG + Intergenic
900495674 1:2974952-2974974 GGAGGCAGGCGGGTGGAGAAGGG - Intergenic
900658708 1:3772569-3772591 GGCCGGGGGCGGGGCGAGAGGGG - Intergenic
900987691 1:6082845-6082867 GGCAGAAGGAGGATGAAGAGAGG - Intronic
901056803 1:6452089-6452111 GGCGGAAGGTGGGTGGGGCGGGG + Exonic
901134248 1:6982801-6982823 GGCCGTAGAGGGGTGGGGAGGGG + Intronic
901442927 1:9290501-9290523 CGCCGAAGGGGGGTGGGGTGGGG + Intergenic
902766419 1:18619133-18619155 GGCCCAAGGCTGGTGGAGCTGGG - Intergenic
903810449 1:26032334-26032356 GGCAGAAGGCGGGTTGCGAGGGG - Intronic
904528992 1:31155533-31155555 GGCCCAAAGCGGGTGGAGCGCGG - Intergenic
905033458 1:34902681-34902703 AGCAGCAGGCAGGTGGAGAGAGG + Intronic
905939076 1:41848675-41848697 GGCAGAAGGCGAGAGCAGAGAGG + Intronic
906301382 1:44684491-44684513 GGCAGAAGGCAGGTGCAGGGAGG + Intronic
906943826 1:50278558-50278580 GGGGGAAGGGGGGTGGGGAGAGG + Intergenic
907404470 1:54245408-54245430 GGCGGGAGGCGGGTGGGAAGGGG + Intronic
909723519 1:78806115-78806137 TGCCAGAGGCTGGTGGAGAGAGG - Intergenic
910025615 1:82647506-82647528 GGCTGGAGGCGGGAAGAGAGTGG - Intergenic
913450121 1:118987548-118987570 CGCGGGAGGCGGGCGGAGAGGGG - Intronic
915357351 1:155263267-155263289 GCCCGAAGGCGGGCGAAGAAAGG + Exonic
917930718 1:179820807-179820829 GGCCGTTGGGAGGTGGAGAGAGG + Intergenic
919789775 1:201283677-201283699 GGCGGGAGGCGGGTGGCGCGCGG - Exonic
919819335 1:201463096-201463118 GGCAGAGGGCAGGTGGAGGGTGG - Intergenic
920120239 1:203650644-203650666 GGGCGAGGGCGGGCGGGGAGCGG + Intronic
920174892 1:204094545-204094567 GGCCCAATGCGGGCAGAGAGAGG + Intronic
920260560 1:204685363-204685385 GGCGGAAGGCGAGCGGAGCGCGG - Intronic
921177720 1:212608575-212608597 GGCCGAAGGCGGGTGGAGAGAGG - Intronic
922255949 1:223893074-223893096 GGACCAAAGCGGGAGGAGAGGGG - Intergenic
922465856 1:225845352-225845374 GGTGGCAGGCGGGGGGAGAGGGG - Exonic
922766573 1:228159268-228159290 GGCCAAGGTGGGGTGGAGAGAGG + Exonic
922796014 1:228340256-228340278 GGCCCAAGGGGGGTGCAGGGAGG - Intronic
923359763 1:233199389-233199411 GGGAGAAGGCAGGAGGAGAGAGG + Intronic
923674079 1:236065162-236065184 GCCGGGAGGCGGGAGGAGAGGGG - Exonic
923818079 1:237402904-237402926 GGGGGAAGGAGGGTGGAGACAGG - Intronic
924337148 1:242995941-242995963 GGACCAAAGCGGGAGGAGAGGGG - Intergenic
924457483 1:244230208-244230230 GTCAGAAGAAGGGTGGAGAGAGG + Intergenic
1064178008 10:13092002-13092024 GGCTGATGGTGGGAGGAGAGGGG + Intronic
1065867123 10:29924072-29924094 GGCTGAAGTCGGGTGGAGTTGGG - Intergenic
1065968017 10:30784498-30784520 GGGGGCAGGCGGGGGGAGAGGGG - Intergenic
1067060764 10:43076964-43076986 GGCCGGAGGCGGGTGGGGTGCGG - Intergenic
1067776744 10:49169918-49169940 GGCAGAAGGCAGGAGGACAGGGG + Intronic
1071875404 10:89838025-89838047 AGACGAAGGCGGGGGGTGAGAGG + Intergenic
1073132649 10:101200160-101200182 GGCAGGAGGTGGGTGAAGAGAGG - Intergenic
1073494575 10:103879659-103879681 GACCGAAGGCTGTAGGAGAGTGG + Intergenic
1075801069 10:125153583-125153605 GGCAGCGGGAGGGTGGAGAGGGG - Intronic
1076775871 10:132697724-132697746 GGCTGAAGTCGGGTGGAAACAGG + Intronic
1077136314 11:1001076-1001098 GGCCGAAGGCGTGAGCAGGGTGG - Intronic
1077248008 11:1548477-1548499 GGCCAGAGGCGGGTGGAGGGAGG - Intergenic
1078093555 11:8282842-8282864 GGCAGAAGAGGGGAGGAGAGAGG - Intergenic
1079127274 11:17726608-17726630 AGCCGGATGCGGGTGGAAAGAGG + Intergenic
1081656232 11:44859187-44859209 GAGCGAAGGTGGGTGCAGAGGGG + Intronic
1082945116 11:58750030-58750052 GGCTGAAGCCTGGTGGGGAGAGG + Intergenic
1083667730 11:64284835-64284857 GGCCGAAGGAGGGAGGAAAAAGG - Intronic
1083900114 11:65639553-65639575 GGCCGGAGGGGGGTGGAGGAGGG - Intronic
1084162312 11:67356518-67356540 AGCTGGAGGCAGGTGGAGAGAGG + Intronic
1084178225 11:67434301-67434323 GGCCGGTGGCGGGTGGCAAGTGG + Intronic
1084372230 11:68751490-68751512 GGCCGTTGGCGGTTGGAGAAGGG + Exonic
1084517414 11:69644335-69644357 GGCTGGAGGTGGGTGGAGAAAGG - Intronic
1084527047 11:69704143-69704165 GGCCGGAGGCGGGGTGTGAGTGG - Exonic
1085458274 11:76678064-76678086 GGCTGGAGACAGGTGGAGAGTGG - Intergenic
1085509811 11:77082526-77082548 GGCAGATGGAGGGTGCAGAGGGG + Intronic
1085790525 11:79493689-79493711 GGCCGAAGCCAGGCGGGGAGAGG - Intergenic
1086080889 11:82901312-82901334 GGCAGGAGGGGGGTGGAGCGCGG - Intronic
1086437954 11:86800384-86800406 GGCCGCAGGCGAGCGGCGAGGGG + Exonic
1088979543 11:114849370-114849392 GGCTGAAGGGGGCTGCAGAGGGG + Intergenic
1089377668 11:118005984-118006006 GGTCGATGGCGTGTGGAGAGCGG + Intergenic
1089690631 11:120184789-120184811 GGATGAAGGAGGGTGGAGACAGG + Intronic
1089694005 11:120205189-120205211 GGCAGTAGGGGTGTGGAGAGGGG - Intergenic
1089864572 11:121620484-121620506 GGATGAAGGGGAGTGGAGAGAGG - Intronic
1090213752 11:124942190-124942212 GGCCCAAGGAGTGGGGAGAGAGG - Intergenic
1091582350 12:1797364-1797386 TGCCGAGGGCGGGAGGAGTGTGG + Intronic
1092211144 12:6647166-6647188 GGCCGCGGGCGGGGGGAGATGGG + Intronic
1095161853 12:38927250-38927272 AGCCGAAGGAGGGTAGAGATAGG - Intergenic
1096656628 12:53096580-53096602 TGGGGAAGGCGGGTGGGGAGCGG + Intergenic
1097188805 12:57209861-57209883 GCCCGAAGGTGGGGGCAGAGGGG + Exonic
1101934791 12:109048440-109048462 GGTTGAAGGGGGGTGGAGGGGGG + Intronic
1102148015 12:110669313-110669335 GGCTGCAGGCAGGTGGAGGGAGG - Intronic
1102699910 12:114830042-114830064 GGATGAAGAAGGGTGGAGAGTGG + Intergenic
1106308252 13:28532369-28532391 GGCAGCAGGCGGGTGGACATGGG - Intergenic
1106944430 13:34811089-34811111 GGAAGCAGGGGGGTGGAGAGTGG - Intergenic
1107012426 13:35681742-35681764 GACCAAAGGAGGGTGGAGTGGGG + Intergenic
1108673085 13:52711435-52711457 GGCTGAAGGGGGCAGGAGAGGGG - Intronic
1110387265 13:74928016-74928038 GGTGGAAGGTGGGAGGAGAGAGG - Intergenic
1110735909 13:78936542-78936564 TGGGGAAGGCTGGTGGAGAGTGG - Intergenic
1112802090 13:103124013-103124035 GGCCCAAGGAAGATGGAGAGGGG - Intergenic
1113307441 13:109093827-109093849 GGCTGAGTGCGGCTGGAGAGGGG - Intronic
1113656666 13:112072295-112072317 GGCCGAGCGTGGGTGGGGAGGGG - Intergenic
1113695471 13:112342861-112342883 CGCCGAGGGCAGGTGGAGGGGGG - Intergenic
1113990513 14:16024204-16024226 GGGCGAAGGAGGGTGGAGCGGGG + Intergenic
1115047551 14:29015051-29015073 GGCGGGGGTCGGGTGGAGAGAGG - Intergenic
1115993182 14:39170412-39170434 GGCCGAATGCCGGGGTAGAGGGG - Intronic
1119845646 14:77827695-77827717 TGCCTAAGGAGGGTGCAGAGAGG + Intronic
1120735798 14:88050971-88050993 GGCTGAAGGCATGTGGAGAATGG - Intergenic
1122230784 14:100305624-100305646 GGCGGAAGGGGGGTGGTGGGTGG - Intronic
1122322697 14:100865166-100865188 GGCCAAATGAGGGTGGGGAGCGG - Intergenic
1122356444 14:101125805-101125827 GGCCGGAGGCAGGAGGAGGGTGG - Intergenic
1122418488 14:101561322-101561344 GGGCGCAGGCGGGCGGAGGGCGG - Intergenic
1122750446 14:103928739-103928761 GGGCGGAGGCGGCTGGAGGGCGG + Intronic
1122864838 14:104598966-104598988 GGCTGAAGATGGCTGGAGAGTGG + Intronic
1123689294 15:22823620-22823642 GGCCGGTGGCGGGTGGCGGGTGG + Intronic
1123996366 15:25720624-25720646 GGCCGAAGGAGGCTGGTGGGAGG + Intronic
1124745958 15:32342549-32342571 GGCAGGAGGAGGGCGGAGAGGGG - Intergenic
1126613050 15:50549110-50549132 GGTAGACGGAGGGTGGAGAGTGG - Intergenic
1127267900 15:57376303-57376325 AGCCGAGGGCGGGTGGTGCGGGG + Intronic
1127606216 15:60591508-60591530 GGCCGGGGGCGGGAGGGGAGGGG - Intronic
1128077319 15:64835781-64835803 GGCCCACGGCGCGTGGAGCGGGG - Intergenic
1128083451 15:64870412-64870434 GGGGGATGGCGGGTGGGGAGAGG - Intronic
1128246195 15:66134460-66134482 GGCAGATTGCGGGTGGGGAGGGG - Intronic
1128396283 15:67229592-67229614 GGAGGAAGGAGGATGGAGAGAGG + Intronic
1128582384 15:68818880-68818902 GGACGAAAGCGGCCGGAGAGAGG + Intronic
1128595212 15:68939600-68939622 GGTAGAAGGTGTGTGGAGAGAGG + Intronic
1129791226 15:78341704-78341726 GGCCGAAGGCGGGAAGGGAGAGG - Intronic
1130124782 15:81084313-81084335 GGCCTAAGCCAGGTGGAGTGAGG - Intronic
1130557809 15:84935234-84935256 GGCCCCAGGTGGGTGGTGAGTGG + Intronic
1132293216 15:100717613-100717635 GGGCTAAGACAGGTGGAGAGTGG + Intergenic
1132551885 16:556944-556966 GCCGGGAGGCGGGTGGGGAGGGG + Intergenic
1132580903 16:684226-684248 GGGCGACGGCGGGTGGTGAGCGG - Exonic
1132626623 16:894457-894479 GGTAGAAGTCGGGTGGACAGGGG - Intronic
1132634983 16:939621-939643 GGCAGAGGCCGCGTGGAGAGTGG - Intronic
1132894785 16:2223667-2223689 GGCCGAAGCCGGGCGGGAAGCGG + Exonic
1132925659 16:2428137-2428159 GGGTGAAGGAGGGTGAAGAGAGG - Intergenic
1133121480 16:3611374-3611396 AGCCGCACTCGGGTGGAGAGGGG - Intronic
1135542522 16:23342844-23342866 GGGAGGAGGAGGGTGGAGAGAGG + Intronic
1136410701 16:30075488-30075510 GGCCGAAGGGTGGTGGTGGGTGG + Intergenic
1136578547 16:31138817-31138839 GGCCGGAGGAGGGAGGAGGGAGG + Intergenic
1136909660 16:34135284-34135306 GGGCGAGGGAGGGTGGAGAGGGG + Intergenic
1138393886 16:56689846-56689868 GGCGGGAGGAGGATGGAGAGTGG + Intronic
1138583970 16:57958643-57958665 CACCGAGGGAGGGTGGAGAGGGG - Intronic
1138723721 16:59112651-59112673 GACCGAAGGTGGTAGGAGAGTGG + Intergenic
1140740801 16:77939382-77939404 GGCCGGAGGCGGGCGGGGTGGGG + Intronic
1140916358 16:79497375-79497397 GGAAGCAGGCGGGTGGAGTGGGG - Intergenic
1141717067 16:85732965-85732987 GGCCGAGGGTGGGTGGAGGTGGG + Intronic
1141904680 16:87016434-87016456 GGGGGAAGGCGGATGGGGAGTGG + Intergenic
1142959351 17:3542951-3542973 GGCAGCAGGGGGGTGGACAGCGG - Intronic
1143018473 17:3904224-3904246 GGCGGGAGGGGTGTGGAGAGAGG + Intronic
1143166308 17:4898968-4898990 AGCCAGAGGCGGGTGGAGCGAGG - Intronic
1143350995 17:6288266-6288288 GCCGGGGGGCGGGTGGAGAGGGG - Intergenic
1143366558 17:6412546-6412568 GCAGGAAGGAGGGTGGAGAGTGG + Intronic
1143599506 17:7935050-7935072 GGCCGAAGGCTGGTGTAGCGGGG - Exonic
1143780812 17:9228371-9228393 GGCCCAGGGAGGCTGGAGAGAGG + Intronic
1144671767 17:17136831-17136853 GGCAGAATGCGGATGGTGAGAGG - Intronic
1144922049 17:18772254-18772276 GGCAGCTGGAGGGTGGAGAGTGG - Intronic
1147336154 17:39727897-39727919 GGCTGAAGGCAGGAGGAGGGTGG - Exonic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1148793055 17:50184360-50184382 AGCCAGAGGCAGGTGGAGAGAGG + Exonic
1148950330 17:51305347-51305369 GGCTGCAGGCTGGTGGGGAGAGG + Intergenic
1151193692 17:72416616-72416638 GGCCGAAGGAGGGGGGTGCGGGG + Intergenic
1152073262 17:78144528-78144550 TGCTGAAGGCGGGTGGGGAAGGG - Intergenic
1153006092 18:500094-500116 GGCTAGAGGCGGGAGGAGAGAGG + Intronic
1153565463 18:6414244-6414266 GGCAGAAAGCGGGTGGAGGGAGG + Intronic
1153636545 18:7117837-7117859 GTCCGAGGGCGGCTGGAGGGAGG - Intergenic
1153814449 18:8780438-8780460 GGCTCAAGAAGGGTGGAGAGTGG + Intronic
1156620938 18:38850827-38850849 TGGAGAAGGAGGGTGGAGAGTGG - Intergenic
1157867360 18:51197767-51197789 GCCCGAAGGAGGGTGGGGGGTGG - Intronic
1158947491 18:62459576-62459598 GGGCTGGGGCGGGTGGAGAGAGG + Intergenic
1159746359 18:72240886-72240908 GCCTGTAGGCGGGTGGAGTGGGG + Intergenic
1159966183 18:74598082-74598104 GGGCGGAGGCGGGGGGAGGGGGG - Intronic
1160720317 19:594307-594329 GGCAGGTGTCGGGTGGAGAGAGG + Intronic
1160819696 19:1052305-1052327 GACCCAAGGCGGGTGGGCAGTGG + Intronic
1161388737 19:4010368-4010390 GGCCGAAGGCAGGTGGGCTGGGG - Intronic
1161528628 19:4773227-4773249 GGCAGAGGGCTGGAGGAGAGAGG - Intergenic
1161966281 19:7550923-7550945 GGCCGAAGATGGGTGGAAAGGGG - Intronic
1162181159 19:8869853-8869875 GGCGGGTGGCGGGTGGAGGGTGG + Intronic
1162343573 19:10106691-10106713 GGCCGAGGGTGGGTGGAGGCGGG - Intronic
1162766506 19:12923028-12923050 GGCTGAAGGCGGAGGGTGAGAGG - Intronic
1162802501 19:13118864-13118886 GGCCGGAGGGGGGCGGGGAGGGG + Intronic
1163722640 19:18905540-18905562 GGCTCAGTGCGGGTGGAGAGGGG + Intronic
1165136781 19:33674621-33674643 GGCGGAGAGCGGGCGGAGAGGGG + Intronic
1165331121 19:35141581-35141603 GGGCGAAGGAGGGCGGGGAGGGG - Intronic
1166679847 19:44759525-44759547 GCAGGAAGGCGGGTGGAGATGGG - Exonic
1167145084 19:47676547-47676569 GGCCGAAGGAAGGTGGGGGGAGG - Intronic
1167619045 19:50551234-50551256 GGCCGGAGGCATGTGGAGGGGGG - Intronic
1168348528 19:55662447-55662469 GGGGGAAGGGAGGTGGAGAGAGG - Intronic
1168554524 19:57326868-57326890 GTCTGAAGGCGGGTGGGGGGGGG - Intronic
925043612 2:753334-753356 TGCAGGAGGCGGCTGGAGAGGGG + Intergenic
925192730 2:1898693-1898715 GGACGCAGGCAGCTGGAGAGTGG + Intronic
925675624 2:6358320-6358342 AGCCGAAGGCAGGAGGTGAGAGG + Intergenic
926707093 2:15844615-15844637 GGCCGAAGCTGGGTGGGGTGGGG - Intergenic
926742785 2:16126151-16126173 GGCAGAAGCTGCGTGGAGAGGGG - Intergenic
927561469 2:24076877-24076899 GGCCTGAGGAGGGTGGCGAGAGG + Intronic
927934314 2:27067282-27067304 GGATGAAGGCTGGTGGAGAATGG + Intronic
928622503 2:33105124-33105146 GGAGGAAGGCTGGTGGACAGGGG - Intronic
929151230 2:38750914-38750936 CGCCGAGGGCGGGGGGGGAGGGG + Intronic
930124227 2:47783512-47783534 GGTCGAAGGCGGGGGCATAGCGG + Intronic
930395404 2:50817110-50817132 GACAGAAGGCGGGTGGAGGAAGG + Intronic
932916342 2:75862727-75862749 GGCGGAAAGTGGGTGGACAGAGG + Intergenic
934882005 2:97991345-97991367 GGCGAAAGGCGGTAGGAGAGAGG + Intronic
935312505 2:101799417-101799439 GGAGGGAGGCAGGTGGAGAGTGG - Intronic
935501721 2:103849130-103849152 GGTGGAAGGTGGGAGGAGAGAGG + Intergenic
935596219 2:104880173-104880195 GGGCGGAGGCGGGTGGGGAGAGG - Intergenic
937441990 2:121923685-121923707 GGCAGAGGGTGGGAGGAGAGAGG - Intergenic
937870081 2:126780372-126780394 GGCCAAAGGCAGGTGGAAACTGG - Intergenic
938418426 2:131123781-131123803 GGCCGAGGGCGGGGGGCGGGGGG - Intronic
941110536 2:161415599-161415621 AGCAGAAGGGGGGAGGAGAGGGG - Intergenic
942044831 2:172094479-172094501 GGCCGAAGGAAGGAGGAGGGGGG - Intergenic
942123947 2:172804709-172804731 GTCCGTAGTGGGGTGGAGAGGGG + Intronic
943703644 2:191013013-191013035 GGGGGAAGGTGGGTGGGGAGGGG + Intronic
944591223 2:201219539-201219561 GGCCCAAGGCATGAGGAGAGAGG + Exonic
945649112 2:212537993-212538015 GCCCGAAGGGCGGTGGAGAGCGG - Intronic
1169513831 20:6295390-6295412 GGCCGGAGGCTGGAGGATAGGGG - Intergenic
1171771373 20:29325475-29325497 GGGCGAGGGAGGGTGGAGCGGGG - Intergenic
1171905137 20:30894006-30894028 GGGCGAGGGAGGGTGGAGCGGGG + Intergenic
1172110889 20:32544296-32544318 GGCAGGGGGCGGGTGGAGAAAGG + Intronic
1172217221 20:33244481-33244503 GGTAGAAGGTGGGAGGAGAGTGG + Intergenic
1173443186 20:43095904-43095926 GGGAGAAAGCGGGAGGAGAGAGG - Intronic
1173443215 20:43096024-43096046 GGGAGAAAGCGGGAGGAGAGAGG - Intronic
1173846981 20:46194381-46194403 GGCCTAAGGAGGCTGGAGAAAGG - Intronic
1174040630 20:47697199-47697221 GGCAGAAGAGGGTTGGAGAGGGG - Intronic
1176297979 21:5084566-5084588 GGCAGCAGGGGGGTGGCGAGGGG + Intergenic
1176389807 21:6157617-6157639 GACCGAAGCAGGGTGGTGAGGGG + Intergenic
1176451012 21:6861245-6861267 GGCTGCAGCCGGGTGGAGGGAGG + Intergenic
1176829180 21:13726296-13726318 GGCTGCAGCCGGGTGGAGGGAGG + Intergenic
1178185832 21:30219124-30219146 GCCCGAGGGAGGGTGGAGAGGGG - Intergenic
1178423318 21:32459313-32459335 GGCGGAGGGAGGGTGGAGAGGGG - Intronic
1178599453 21:33983506-33983528 GGGAGAAGGAGTGTGGAGAGAGG - Intergenic
1178610218 21:34073445-34073467 GGCCGCCCGCGGGCGGAGAGGGG + Intronic
1178780884 21:35602806-35602828 GGCTGCAGGAGGGAGGAGAGGGG + Intronic
1179321918 21:40300454-40300476 TGCTGAAGCCGGGTGGACAGAGG - Intronic
1179733660 21:43380621-43380643 GACCGAAGCAGGGTGGTGAGGGG - Intergenic
1179789084 21:43745460-43745482 GGCCTAAGGCAGGGGGAGTGGGG + Intronic
1179859050 21:44177383-44177405 GGCAGCAGGGGGGTGGCGAGGGG - Intergenic
1180057364 21:45365793-45365815 CTCCGAGCGCGGGTGGAGAGAGG + Intergenic
1180159183 21:45991443-45991465 GGCGGGAGGAGGGTGGTGAGCGG + Intronic
1180258239 21:46649016-46649038 GGCCTAAGAGGGGTGGGGAGGGG - Intronic
1180338564 22:11600186-11600208 GGGCGAGGGAGGGTGGAGCGGGG + Intergenic
1180738211 22:18034609-18034631 GGCGGGAGGCGGGTGGAGGGGGG + Intergenic
1180844308 22:18973057-18973079 GGCCACAGGTGAGTGGAGAGGGG + Intergenic
1181057163 22:20265654-20265676 GGCCACAGGTGAGTGGAGAGGGG - Intronic
1181260053 22:21591155-21591177 GGCCTCATGCAGGTGGAGAGGGG + Intronic
1181567924 22:23751019-23751041 GGCCGCAGGCGGGCGGGGCGGGG + Exonic
1182236922 22:28883520-28883542 GGCCGAGGGCGGGGAGGGAGGGG + Intergenic
1183080171 22:35451126-35451148 GGCCCAAGGTGGCTGCAGAGAGG - Intergenic
1183654139 22:39175378-39175400 GGCCTTGGGCGGGTGGAGAACGG - Intergenic
1184452414 22:44590986-44591008 GGGCCAAGGCAGGTGGAGACGGG + Intergenic
1184743045 22:46440141-46440163 GTCTGAGGGCGGATGGAGAGAGG - Intronic
1185053006 22:48563474-48563496 GTCTGAAGGCGGGTGGCGTGTGG + Intronic
1185368148 22:50446359-50446381 GGCCGGAGGCGGGGGGGGGGGGG - Exonic
950404669 3:12797087-12797109 GGCCGAGGCAGGGTGCAGAGGGG - Intronic
951217840 3:20040880-20040902 GGCCCCAGGCGGGAGGCGAGAGG - Intronic
951558621 3:23945223-23945245 GGCCGAGGGCGGGCGGAGGGAGG + Intronic
952593538 3:34987874-34987896 GGGAGAAGGCGGATGAAGAGAGG + Intergenic
954447967 3:50556868-50556890 GGCAGAAGGTGGGTGGAAGGGGG + Intergenic
955226557 3:57065050-57065072 GGGAGAAGTAGGGTGGAGAGAGG + Intronic
956598629 3:70995214-70995236 GGCCCACGGCCGGTGGACAGTGG + Intronic
961034079 3:123630062-123630084 AGCTGAAGGTGTGTGGAGAGAGG - Intronic
962728768 3:138260227-138260249 GGAAGAAGGCGGGTGAGGAGAGG - Intronic
968474305 4:795781-795803 GCCCCAAACCGGGTGGAGAGGGG + Intronic
969138793 4:5051634-5051656 GGCGGAAGGCGCGGCGAGAGCGG + Exonic
969453607 4:7288555-7288577 GGCGGGGGGCGGGGGGAGAGGGG + Intronic
969717077 4:8872930-8872952 GGCGGTACTCGGGTGGAGAGGGG - Intergenic
970132361 4:12885661-12885683 GGCCGGGGGTGGGTGGGGAGGGG - Intergenic
970720911 4:18987584-18987606 GGCTGCGGGTGGGTGGAGAGGGG + Intergenic
972607754 4:40629887-40629909 GGCGGGCGGCGGGAGGAGAGAGG - Intronic
973271780 4:48269680-48269702 GGGCGAGGACGGGTGGGGAGGGG - Intronic
975411540 4:74057786-74057808 GGCTGAAAGTGGGAGGAGAGTGG + Intergenic
975674457 4:76812371-76812393 GGCCGAAGGCGGGAGGGAAAAGG - Intergenic
976617442 4:87092950-87092972 GACCGAAGGTGGGGGCAGAGTGG - Intronic
976713369 4:88097732-88097754 GACCGAGGGTGGTTGGAGAGTGG - Intronic
981722475 4:147815463-147815485 GGCCGGAGGCGGGGGGCGGGGGG + Intronic
982745674 4:159102920-159102942 GGCCGCTGGCGGGCGGGGAGCGG + Intergenic
985482103 5:119721-119743 GGCTGGAGGAGGATGGAGAGGGG + Intergenic
986011247 5:3717696-3717718 TGCTGAGGGCGGGGGGAGAGAGG + Intergenic
987193556 5:15502251-15502273 GGCGGGAGGCGGGTGGGGTGGGG - Intronic
988779360 5:34505565-34505587 GGCAGAAGGGGAGTTGAGAGAGG + Intergenic
989168297 5:38451464-38451486 TGCTGAAGGCAGATGGAGAGGGG - Intronic
990378935 5:55202422-55202444 GGCCGAGGGCGGGTGGGGGCAGG + Intergenic
990446232 5:55896677-55896699 GGGGGAAGGGGAGTGGAGAGGGG - Intronic
991707103 5:69369217-69369239 GGGCGGGGGGGGGTGGAGAGAGG - Intronic
996100994 5:119445671-119445693 GGGCGCAGGCGGGTGGAAAAGGG - Intergenic
999287294 5:150401831-150401853 GGCCAAAGGCTGGAGGGGAGAGG + Intronic
999921902 5:156330335-156330357 GGCAGAAGTGGGGTTGAGAGAGG + Intronic
1001234079 5:170014742-170014764 GGCAGTAGGCAGGTGGAGGGAGG + Intronic
1001524877 5:172421704-172421726 GGGCAAAGGCCTGTGGAGAGAGG + Intronic
1003767292 6:9253214-9253236 GGCCAAAGGGAGGTGGAGAAGGG - Intergenic
1004157551 6:13183625-13183647 GGAGGAAGGAGGGTGGGGAGGGG + Intronic
1004216667 6:13710848-13710870 GGTCGGGGGCGGGTCGAGAGCGG + Intronic
1006097835 6:31666743-31666765 GGCCGAATGTGGGAGGAGGGAGG + Intronic
1006384194 6:33720115-33720137 AGGGGAGGGCGGGTGGAGAGTGG - Intergenic
1006452743 6:34114569-34114591 GGCAGAGGGTGAGTGGAGAGGGG - Intronic
1006699751 6:35962470-35962492 GGCAGAGGGAGGTTGGAGAGAGG - Intronic
1007257432 6:40538730-40538752 GACCGGGGGCAGGTGGAGAGGGG - Intronic
1007293279 6:40802687-40802709 GGCAGAGAGTGGGTGGAGAGGGG + Intergenic
1007462853 6:42030744-42030766 GGCCGGAGGCAGATGGAAAGGGG - Intronic
1014205380 6:118651104-118651126 GGCCTGAGGCGGGAGGGGAGCGG + Intronic
1015769019 6:136750044-136750066 GGCCAATGGGGTGTGGAGAGAGG - Intronic
1018618355 6:165708773-165708795 GGCAGCATGTGGGTGGAGAGTGG - Intronic
1018618390 6:165708908-165708930 GGCAGCATGGGGGTGGAGAGTGG - Intronic
1018618399 6:165708942-165708964 GGCAGCATGGGGGTGGAGAGTGG - Intronic
1018618410 6:165708976-165708998 GGCAGCATGGGGGTGGAGAGTGG - Intronic
1018618421 6:165709010-165709032 GGCAGCATGGGGGTGGAGAGTGG - Intronic
1018618439 6:165709079-165709101 GGCAGCATGTGGGTGGAGAGTGG - Intronic
1018689208 6:166330769-166330791 GGCCGAAGGGAGGTGGCGTGTGG - Intronic
1018844645 6:167547293-167547315 GGCAGGAGGAGGGAGGAGAGAGG - Intergenic
1018876579 6:167827029-167827051 GGCCGGCGGGGGGTGGCGAGGGG + Exonic
1019210129 6:170398011-170398033 GGCCTCAGGAAGGTGGAGAGGGG + Intronic
1019505653 7:1389157-1389179 GGCCGTGGGCGGACGGAGAGGGG + Intergenic
1021697081 7:23286246-23286268 GGGGGAAGGAGGGGGGAGAGGGG - Intergenic
1021697118 7:23286328-23286350 GGGGGAAGGAGGGAGGAGAGGGG - Intergenic
1028040333 7:86044524-86044546 GGCCTATGGAGGGTGGAGGGTGG - Intergenic
1028561334 7:92179293-92179315 CGCTGCAGGCGGGTGGAGAACGG + Intronic
1029363323 7:100101978-100102000 GGCGGGAGGCGGGTGAGGAGCGG + Intronic
1030227454 7:107169092-107169114 GGCCGACGTCGGTCGGAGAGGGG + Exonic
1035473800 7:159128457-159128479 GGCCCAAGGCAGGAGGGGAGTGG - Intronic
1038414170 8:27381322-27381344 GGTGGAAGGTGGATGGAGAGAGG - Intronic
1038807991 8:30812474-30812496 GGCCGGGGGCGGGTGGGGAGGGG - Exonic
1041692676 8:60704291-60704313 TGCCCAAGGCTGGTGGACAGTGG + Intronic
1042576044 8:70219674-70219696 GGCAGGAGGAGGGTGGAGGGGGG + Intronic
1043477212 8:80616887-80616909 AGCAGCAGGCTGGTGGAGAGTGG - Intergenic
1045038214 8:98194117-98194139 TGCTGAGGGCGGGTGGACAGGGG + Intronic
1046806741 8:118487072-118487094 GGGCAAAGACGGGTGCAGAGTGG + Intronic
1047204040 8:122789147-122789169 GGCGGAGGGAGGGTGGAGAATGG + Intronic
1050718839 9:8561602-8561624 GGGTGAGGGGGGGTGGAGAGTGG + Intronic
1051521665 9:17996217-17996239 GGCAGGAGGTGGGTGGAGAGTGG - Intergenic
1052552594 9:29970014-29970036 GACCGAAGGTGGGTTGAGTGTGG - Intergenic
1053564419 9:39233287-39233309 GGCTGGAGGCGGGTGGGGTGGGG + Intronic
1053830200 9:42071188-42071210 GGCTGGAGGCGGGTGGGGTGGGG + Intronic
1054132731 9:61385749-61385771 GGCTGGAGGCGGGTGGGGTGGGG - Intergenic
1054600359 9:67116264-67116286 GGCTGGAGGCGGGTGGGGTGGGG - Intergenic
1054913610 9:70476308-70476330 AGCCGGAGGAGAGTGGAGAGAGG - Intergenic
1056689859 9:88798751-88798773 GCCCCAAGGTGGGTGGTGAGGGG + Intergenic
1057020974 9:91697468-91697490 TGGGGAAGGTGGGTGGAGAGGGG + Intronic
1057600226 9:96450750-96450772 CGCCGAAGGTAGGAGGAGAGGGG + Intronic
1058467543 9:105244558-105244580 GGCGGGAGGCGGGGGGACAGAGG + Intergenic
1058985820 9:110207675-110207697 GGCAAAAGGAGGGTGGAAAGAGG + Exonic
1059208334 9:112487000-112487022 GCGCGAGGGCGGGAGGAGAGCGG - Exonic
1059788769 9:117616934-117616956 AGACGAAGTCAGGTGGAGAGAGG - Intergenic
1061660269 9:132125486-132125508 GGCAGGAGGCGGGCTGAGAGGGG - Intergenic
1203518169 Un_GL000213v1:23272-23294 GGCTGCAGCCGGGTGGAGGGAGG - Intergenic
1203365066 Un_KI270442v1:249257-249279 GGGCGACGGTGGGTGGAGCGGGG - Intergenic
1188194887 X:27221445-27221467 GGCCTACTGAGGGTGGAGAGTGG - Intergenic
1190765634 X:53473481-53473503 GGGCAAAGGAGGGAGGAGAGAGG + Intergenic
1191703214 X:64065139-64065161 GGTGGAAGGTGGGAGGAGAGAGG - Intergenic
1191862109 X:65674159-65674181 GGCTGAAGGGAGGTAGAGAGAGG + Intronic
1192118642 X:68434156-68434178 GTCCGAAGGAGGCTGGAAAGAGG - Intergenic
1192247646 X:69386961-69386983 GGCCGAAAGTCAGTGGAGAGGGG + Intergenic
1192428126 X:71095361-71095383 GGATGAAGGCGGGTGGAGGGAGG + Intergenic
1195318878 X:103705110-103705132 GCCCGAAGGCGGGGGTAGCGGGG - Intergenic
1200233895 X:154459162-154459184 GGCGGGAGGCGGGGGGGGAGCGG - Intronic
1200256377 X:154585212-154585234 GGCCGAAGGCCGGGGCACAGGGG + Exonic
1200261392 X:154619191-154619213 GGCCGAAGGCCGGGGCACAGGGG - Exonic
1200267375 X:154653488-154653510 GGCCGAAGGCCGGGGCACAGGGG - Exonic
1201294506 Y:12452169-12452191 GGCAGAGGGTGGGAGGAGAGTGG + Intergenic