ID: 921181822

View in Genome Browser
Species Human (GRCh38)
Location 1:212637380-212637402
Sequence CATGTAGCTCATTCTCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921181822_921181826 21 Left 921181822 1:212637380-212637402 CCACAGGGAGAATGAGCTACATG No data
Right 921181826 1:212637424-212637446 TAATTTCTAGAAAGAGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921181822 Original CRISPR CATGTAGCTCATTCTCCCTG TGG (reversed) Intergenic
No off target data available for this crispr