ID: 921182987

View in Genome Browser
Species Human (GRCh38)
Location 1:212645984-212646006
Sequence GGCTGGGTTTGGTGGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921182983_921182987 -10 Left 921182983 1:212645971-212645993 CCAGTGGGGAGGAGGCTGGGTTT No data
Right 921182987 1:212645984-212646006 GGCTGGGTTTGGTGGGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921182987 Original CRISPR GGCTGGGTTTGGTGGGCAGA TGG Intergenic
No off target data available for this crispr