ID: 921187397

View in Genome Browser
Species Human (GRCh38)
Location 1:212682452-212682474
Sequence GTGTGGTAGAATGCAAACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921187390_921187397 6 Left 921187390 1:212682423-212682445 CCAGAGCCCATCTCTGGCCTTTC No data
Right 921187397 1:212682452-212682474 GTGTGGTAGAATGCAAACAATGG No data
921187392_921187397 0 Left 921187392 1:212682429-212682451 CCCATCTCTGGCCTTTCAGGATG No data
Right 921187397 1:212682452-212682474 GTGTGGTAGAATGCAAACAATGG No data
921187393_921187397 -1 Left 921187393 1:212682430-212682452 CCATCTCTGGCCTTTCAGGATGG No data
Right 921187397 1:212682452-212682474 GTGTGGTAGAATGCAAACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921187397 Original CRISPR GTGTGGTAGAATGCAAACAA TGG Intergenic
No off target data available for this crispr